ID: 1177068404

View in Genome Browser
Species Human (GRCh38)
Location 21:16469035-16469057
Sequence ACACTGAGCCCTTTTTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177068404_1177068406 29 Left 1177068404 21:16469035-16469057 CCAAAAGAAAAAGGGCTCAGTGT No data
Right 1177068406 21:16469087-16469109 AATAATATGAAAATTTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177068404 Original CRISPR ACACTGAGCCCTTTTTCTTT TGG (reversed) Intergenic
No off target data available for this crispr