ID: 1177081261

View in Genome Browser
Species Human (GRCh38)
Location 21:16641331-16641353
Sequence CTGGCCAGCAGTAAAATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177081250_1177081261 28 Left 1177081250 21:16641280-16641302 CCTTGCCTCGGTAGCTTCCAGTG No data
Right 1177081261 21:16641331-16641353 CTGGCCAGCAGTAAAATTGATGG No data
1177081251_1177081261 23 Left 1177081251 21:16641285-16641307 CCTCGGTAGCTTCCAGTGCAAAT No data
Right 1177081261 21:16641331-16641353 CTGGCCAGCAGTAAAATTGATGG No data
1177081256_1177081261 -8 Left 1177081256 21:16641316-16641338 CCATGCCACCCCATTCTGGCCAG No data
Right 1177081261 21:16641331-16641353 CTGGCCAGCAGTAAAATTGATGG No data
1177081253_1177081261 11 Left 1177081253 21:16641297-16641319 CCAGTGCAAATAAAGGTACCCAT No data
Right 1177081261 21:16641331-16641353 CTGGCCAGCAGTAAAATTGATGG No data
1177081255_1177081261 -7 Left 1177081255 21:16641315-16641337 CCCATGCCACCCCATTCTGGCCA No data
Right 1177081261 21:16641331-16641353 CTGGCCAGCAGTAAAATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177081261 Original CRISPR CTGGCCAGCAGTAAAATTGA TGG Intergenic
No off target data available for this crispr