ID: 1177083253

View in Genome Browser
Species Human (GRCh38)
Location 21:16668656-16668678
Sequence ATCCAATCCAGTATCTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177083253_1177083254 20 Left 1177083253 21:16668656-16668678 CCTGTAAAGATACTGGATTGGAT No data
Right 1177083254 21:16668699-16668721 CTCCTATAAACGAAATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177083253 Original CRISPR ATCCAATCCAGTATCTTTAC AGG (reversed) Intergenic
No off target data available for this crispr