ID: 1177094473

View in Genome Browser
Species Human (GRCh38)
Location 21:16815483-16815505
Sequence GTGTAAAATGAAACCACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177094473_1177094474 21 Left 1177094473 21:16815483-16815505 CCTTCAGTGGTTTCATTTTACAC No data
Right 1177094474 21:16815527-16815549 TTACAACTCCTTGTGTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177094473 Original CRISPR GTGTAAAATGAAACCACTGA AGG (reversed) Intergenic
No off target data available for this crispr