ID: 1177097945

View in Genome Browser
Species Human (GRCh38)
Location 21:16861667-16861689
Sequence GCAGTAGGCAGAAGCATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177097942_1177097945 -8 Left 1177097942 21:16861652-16861674 CCTCCTAGGCTTTAGGCAGTAGG No data
Right 1177097945 21:16861667-16861689 GCAGTAGGCAGAAGCATCAATGG No data
1177097937_1177097945 14 Left 1177097937 21:16861630-16861652 CCACACTCCCTTCTCTTCTACTC No data
Right 1177097945 21:16861667-16861689 GCAGTAGGCAGAAGCATCAATGG No data
1177097939_1177097945 6 Left 1177097939 21:16861638-16861660 CCTTCTCTTCTACTCCTCCTAGG No data
Right 1177097945 21:16861667-16861689 GCAGTAGGCAGAAGCATCAATGG No data
1177097938_1177097945 7 Left 1177097938 21:16861637-16861659 CCCTTCTCTTCTACTCCTCCTAG No data
Right 1177097945 21:16861667-16861689 GCAGTAGGCAGAAGCATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177097945 Original CRISPR GCAGTAGGCAGAAGCATCAA TGG Intergenic
No off target data available for this crispr