ID: 1177104841

View in Genome Browser
Species Human (GRCh38)
Location 21:16943030-16943052
Sequence GTTCAGCGGCACTATACTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177104841_1177104843 -7 Left 1177104841 21:16943030-16943052 CCTATAGTATAGTGCCGCTGAAC No data
Right 1177104843 21:16943046-16943068 GCTGAACAGCCATTCTGATTTGG 0: 2
1: 28
2: 73
3: 65
4: 138
1177104841_1177104845 5 Left 1177104841 21:16943030-16943052 CCTATAGTATAGTGCCGCTGAAC No data
Right 1177104845 21:16943058-16943080 TTCTGATTTGGTGTCAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177104841 Original CRISPR GTTCAGCGGCACTATACTAT AGG (reversed) Intergenic
No off target data available for this crispr