ID: 1177110646

View in Genome Browser
Species Human (GRCh38)
Location 21:17023679-17023701
Sequence AACTGCCTGTAGAGGGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177110646_1177110651 20 Left 1177110646 21:17023679-17023701 CCTTCAACCCTCTACAGGCAGTT No data
Right 1177110651 21:17023722-17023744 GGCAAACTCATTTCTGCCTCAGG No data
1177110646_1177110650 -1 Left 1177110646 21:17023679-17023701 CCTTCAACCCTCTACAGGCAGTT No data
Right 1177110650 21:17023701-17023723 TAATATAGAGGAAGAAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177110646 Original CRISPR AACTGCCTGTAGAGGGTTGA AGG (reversed) Intergenic
No off target data available for this crispr