ID: 1177115128

View in Genome Browser
Species Human (GRCh38)
Location 21:17075848-17075870
Sequence TTGAGTCAGCAAATCTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177115122_1177115128 23 Left 1177115122 21:17075802-17075824 CCATAGGAAATTAGATGCTTTGG No data
Right 1177115128 21:17075848-17075870 TTGAGTCAGCAAATCTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177115128 Original CRISPR TTGAGTCAGCAAATCTATCT AGG Intergenic
No off target data available for this crispr