ID: 1177117316

View in Genome Browser
Species Human (GRCh38)
Location 21:17102077-17102099
Sequence TCAACTAGGAGGAGAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177117312_1177117316 10 Left 1177117312 21:17102044-17102066 CCATTGATTCTGATCTCTTGTTT No data
Right 1177117316 21:17102077-17102099 TCAACTAGGAGGAGAAACACTGG No data
1177117311_1177117316 11 Left 1177117311 21:17102043-17102065 CCCATTGATTCTGATCTCTTGTT No data
Right 1177117316 21:17102077-17102099 TCAACTAGGAGGAGAAACACTGG No data
1177117310_1177117316 28 Left 1177117310 21:17102026-17102048 CCTAAATGTCTTCTTCTCCCATT No data
Right 1177117316 21:17102077-17102099 TCAACTAGGAGGAGAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177117316 Original CRISPR TCAACTAGGAGGAGAAACAC TGG Intergenic
No off target data available for this crispr