ID: 1177119590

View in Genome Browser
Species Human (GRCh38)
Location 21:17123830-17123852
Sequence CATCCCACACAGATGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177119590_1177119593 -9 Left 1177119590 21:17123830-17123852 CCATGTCCCATCTGTGTGGGATG No data
Right 1177119593 21:17123844-17123866 TGTGGGATGCCACTGAAAATAGG No data
1177119590_1177119595 9 Left 1177119590 21:17123830-17123852 CCATGTCCCATCTGTGTGGGATG No data
Right 1177119595 21:17123862-17123884 ATAGGACTGTTCAACTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177119590 Original CRISPR CATCCCACACAGATGGGACA TGG (reversed) Intergenic
No off target data available for this crispr