ID: 1177121994

View in Genome Browser
Species Human (GRCh38)
Location 21:17149249-17149271
Sequence CTCTAGATTGACTCTTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177121994_1177121997 -10 Left 1177121994 21:17149249-17149271 CCCACAAAAGAGTCAATCTAGAG No data
Right 1177121997 21:17149262-17149284 CAATCTAGAGGTCAATAACAAGG No data
1177121994_1177122000 -7 Left 1177121994 21:17149249-17149271 CCCACAAAAGAGTCAATCTAGAG No data
Right 1177122000 21:17149265-17149287 TCTAGAGGTCAATAACAAGGGGG No data
1177121994_1177121999 -8 Left 1177121994 21:17149249-17149271 CCCACAAAAGAGTCAATCTAGAG No data
Right 1177121999 21:17149264-17149286 ATCTAGAGGTCAATAACAAGGGG No data
1177121994_1177122001 0 Left 1177121994 21:17149249-17149271 CCCACAAAAGAGTCAATCTAGAG No data
Right 1177122001 21:17149272-17149294 GTCAATAACAAGGGGGATTTTGG No data
1177121994_1177121998 -9 Left 1177121994 21:17149249-17149271 CCCACAAAAGAGTCAATCTAGAG No data
Right 1177121998 21:17149263-17149285 AATCTAGAGGTCAATAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177121994 Original CRISPR CTCTAGATTGACTCTTTTGT GGG (reversed) Intergenic
No off target data available for this crispr