ID: 1177121997

View in Genome Browser
Species Human (GRCh38)
Location 21:17149262-17149284
Sequence CAATCTAGAGGTCAATAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177121994_1177121997 -10 Left 1177121994 21:17149249-17149271 CCCACAAAAGAGTCAATCTAGAG No data
Right 1177121997 21:17149262-17149284 CAATCTAGAGGTCAATAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177121997 Original CRISPR CAATCTAGAGGTCAATAACA AGG Intergenic
No off target data available for this crispr