ID: 1177121999

View in Genome Browser
Species Human (GRCh38)
Location 21:17149264-17149286
Sequence ATCTAGAGGTCAATAACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177121994_1177121999 -8 Left 1177121994 21:17149249-17149271 CCCACAAAAGAGTCAATCTAGAG No data
Right 1177121999 21:17149264-17149286 ATCTAGAGGTCAATAACAAGGGG No data
1177121995_1177121999 -9 Left 1177121995 21:17149250-17149272 CCACAAAAGAGTCAATCTAGAGG No data
Right 1177121999 21:17149264-17149286 ATCTAGAGGTCAATAACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177121999 Original CRISPR ATCTAGAGGTCAATAACAAG GGG Intergenic
No off target data available for this crispr