ID: 1177122001

View in Genome Browser
Species Human (GRCh38)
Location 21:17149272-17149294
Sequence GTCAATAACAAGGGGGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177121995_1177122001 -1 Left 1177121995 21:17149250-17149272 CCACAAAAGAGTCAATCTAGAGG No data
Right 1177122001 21:17149272-17149294 GTCAATAACAAGGGGGATTTTGG No data
1177121994_1177122001 0 Left 1177121994 21:17149249-17149271 CCCACAAAAGAGTCAATCTAGAG No data
Right 1177122001 21:17149272-17149294 GTCAATAACAAGGGGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177122001 Original CRISPR GTCAATAACAAGGGGGATTT TGG Intergenic
No off target data available for this crispr