ID: 1177124827

View in Genome Browser
Species Human (GRCh38)
Location 21:17182499-17182521
Sequence CAACCTTAAGTTATCAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177124827_1177124837 28 Left 1177124827 21:17182499-17182521 CCATTATTGATAACTTAAGGTTG No data
Right 1177124837 21:17182550-17182572 CTTTAATACCCCAATATTCAGGG No data
1177124827_1177124836 27 Left 1177124827 21:17182499-17182521 CCATTATTGATAACTTAAGGTTG No data
Right 1177124836 21:17182549-17182571 CCTTTAATACCCCAATATTCAGG No data
1177124827_1177124829 -2 Left 1177124827 21:17182499-17182521 CCATTATTGATAACTTAAGGTTG No data
Right 1177124829 21:17182520-17182542 TGCAAGGCCTCCTCAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177124827 Original CRISPR CAACCTTAAGTTATCAATAA TGG (reversed) Intergenic