ID: 1177124830

View in Genome Browser
Species Human (GRCh38)
Location 21:17182527-17182549
Sequence GGCTGTTCCAGGGTTTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177124830_1177124843 23 Left 1177124830 21:17182527-17182549 CCTCCTCAAACCCTGGAACAGCC No data
Right 1177124843 21:17182573-17182595 CACAAAAACCCAGTTGGGAATGG No data
1177124830_1177124837 0 Left 1177124830 21:17182527-17182549 CCTCCTCAAACCCTGGAACAGCC No data
Right 1177124837 21:17182550-17182572 CTTTAATACCCCAATATTCAGGG No data
1177124830_1177124842 18 Left 1177124830 21:17182527-17182549 CCTCCTCAAACCCTGGAACAGCC No data
Right 1177124842 21:17182568-17182590 CAGGGCACAAAAACCCAGTTGGG No data
1177124830_1177124836 -1 Left 1177124830 21:17182527-17182549 CCTCCTCAAACCCTGGAACAGCC No data
Right 1177124836 21:17182549-17182571 CCTTTAATACCCCAATATTCAGG No data
1177124830_1177124841 17 Left 1177124830 21:17182527-17182549 CCTCCTCAAACCCTGGAACAGCC No data
Right 1177124841 21:17182567-17182589 TCAGGGCACAAAAACCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177124830 Original CRISPR GGCTGTTCCAGGGTTTGAGG AGG (reversed) Intergenic