ID: 1177124832

View in Genome Browser
Species Human (GRCh38)
Location 21:17182537-17182559
Sequence GGTATTAAAGGGCTGTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177124832_1177124842 8 Left 1177124832 21:17182537-17182559 CCCTGGAACAGCCCTTTAATACC No data
Right 1177124842 21:17182568-17182590 CAGGGCACAAAAACCCAGTTGGG No data
1177124832_1177124841 7 Left 1177124832 21:17182537-17182559 CCCTGGAACAGCCCTTTAATACC No data
Right 1177124841 21:17182567-17182589 TCAGGGCACAAAAACCCAGTTGG No data
1177124832_1177124837 -10 Left 1177124832 21:17182537-17182559 CCCTGGAACAGCCCTTTAATACC No data
Right 1177124837 21:17182550-17182572 CTTTAATACCCCAATATTCAGGG No data
1177124832_1177124843 13 Left 1177124832 21:17182537-17182559 CCCTGGAACAGCCCTTTAATACC No data
Right 1177124843 21:17182573-17182595 CACAAAAACCCAGTTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177124832 Original CRISPR GGTATTAAAGGGCTGTTCCA GGG (reversed) Intergenic