ID: 1177124836

View in Genome Browser
Species Human (GRCh38)
Location 21:17182549-17182571
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177124827_1177124836 27 Left 1177124827 21:17182499-17182521 CCATTATTGATAACTTAAGGTTG No data
Right 1177124836 21:17182549-17182571 CCTTTAATACCCCAATATTCAGG No data
1177124830_1177124836 -1 Left 1177124830 21:17182527-17182549 CCTCCTCAAACCCTGGAACAGCC No data
Right 1177124836 21:17182549-17182571 CCTTTAATACCCCAATATTCAGG No data
1177124831_1177124836 -4 Left 1177124831 21:17182530-17182552 CCTCAAACCCTGGAACAGCCCTT No data
Right 1177124836 21:17182549-17182571 CCTTTAATACCCCAATATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177124836 Original CRISPR CCTTTAATACCCCAATATTC AGG Intergenic