ID: 1177124837

View in Genome Browser
Species Human (GRCh38)
Location 21:17182550-17182572
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177124830_1177124837 0 Left 1177124830 21:17182527-17182549 CCTCCTCAAACCCTGGAACAGCC No data
Right 1177124837 21:17182550-17182572 CTTTAATACCCCAATATTCAGGG No data
1177124831_1177124837 -3 Left 1177124831 21:17182530-17182552 CCTCAAACCCTGGAACAGCCCTT No data
Right 1177124837 21:17182550-17182572 CTTTAATACCCCAATATTCAGGG No data
1177124832_1177124837 -10 Left 1177124832 21:17182537-17182559 CCCTGGAACAGCCCTTTAATACC No data
Right 1177124837 21:17182550-17182572 CTTTAATACCCCAATATTCAGGG No data
1177124827_1177124837 28 Left 1177124827 21:17182499-17182521 CCATTATTGATAACTTAAGGTTG No data
Right 1177124837 21:17182550-17182572 CTTTAATACCCCAATATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177124837 Original CRISPR CTTTAATACCCCAATATTCA GGG Intergenic