ID: 1177124841

View in Genome Browser
Species Human (GRCh38)
Location 21:17182567-17182589
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177124830_1177124841 17 Left 1177124830 21:17182527-17182549 CCTCCTCAAACCCTGGAACAGCC No data
Right 1177124841 21:17182567-17182589 TCAGGGCACAAAAACCCAGTTGG No data
1177124834_1177124841 -4 Left 1177124834 21:17182548-17182570 CCCTTTAATACCCCAATATTCAG No data
Right 1177124841 21:17182567-17182589 TCAGGGCACAAAAACCCAGTTGG No data
1177124831_1177124841 14 Left 1177124831 21:17182530-17182552 CCTCAAACCCTGGAACAGCCCTT No data
Right 1177124841 21:17182567-17182589 TCAGGGCACAAAAACCCAGTTGG No data
1177124832_1177124841 7 Left 1177124832 21:17182537-17182559 CCCTGGAACAGCCCTTTAATACC No data
Right 1177124841 21:17182567-17182589 TCAGGGCACAAAAACCCAGTTGG No data
1177124835_1177124841 -5 Left 1177124835 21:17182549-17182571 CCTTTAATACCCCAATATTCAGG No data
Right 1177124841 21:17182567-17182589 TCAGGGCACAAAAACCCAGTTGG No data
1177124833_1177124841 6 Left 1177124833 21:17182538-17182560 CCTGGAACAGCCCTTTAATACCC No data
Right 1177124841 21:17182567-17182589 TCAGGGCACAAAAACCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177124841 Original CRISPR TCAGGGCACAAAAACCCAGT TGG Intergenic