ID: 1177124843

View in Genome Browser
Species Human (GRCh38)
Location 21:17182573-17182595
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177124832_1177124843 13 Left 1177124832 21:17182537-17182559 CCCTGGAACAGCCCTTTAATACC No data
Right 1177124843 21:17182573-17182595 CACAAAAACCCAGTTGGGAATGG No data
1177124831_1177124843 20 Left 1177124831 21:17182530-17182552 CCTCAAACCCTGGAACAGCCCTT No data
Right 1177124843 21:17182573-17182595 CACAAAAACCCAGTTGGGAATGG No data
1177124834_1177124843 2 Left 1177124834 21:17182548-17182570 CCCTTTAATACCCCAATATTCAG No data
Right 1177124843 21:17182573-17182595 CACAAAAACCCAGTTGGGAATGG No data
1177124835_1177124843 1 Left 1177124835 21:17182549-17182571 CCTTTAATACCCCAATATTCAGG No data
Right 1177124843 21:17182573-17182595 CACAAAAACCCAGTTGGGAATGG No data
1177124833_1177124843 12 Left 1177124833 21:17182538-17182560 CCTGGAACAGCCCTTTAATACCC No data
Right 1177124843 21:17182573-17182595 CACAAAAACCCAGTTGGGAATGG No data
1177124840_1177124843 -10 Left 1177124840 21:17182560-17182582 CCAATATTCAGGGCACAAAAACC No data
Right 1177124843 21:17182573-17182595 CACAAAAACCCAGTTGGGAATGG No data
1177124830_1177124843 23 Left 1177124830 21:17182527-17182549 CCTCCTCAAACCCTGGAACAGCC No data
Right 1177124843 21:17182573-17182595 CACAAAAACCCAGTTGGGAATGG No data
1177124839_1177124843 -9 Left 1177124839 21:17182559-17182581 CCCAATATTCAGGGCACAAAAAC No data
Right 1177124843 21:17182573-17182595 CACAAAAACCCAGTTGGGAATGG No data
1177124838_1177124843 -8 Left 1177124838 21:17182558-17182580 CCCCAATATTCAGGGCACAAAAA No data
Right 1177124843 21:17182573-17182595 CACAAAAACCCAGTTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177124843 Original CRISPR CACAAAAACCCAGTTGGGAA TGG Intergenic