ID: 1177139421

View in Genome Browser
Species Human (GRCh38)
Location 21:17342298-17342320
Sequence GGTTATCTGCAGGAGACGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177139415_1177139421 15 Left 1177139415 21:17342260-17342282 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1177139421 21:17342298-17342320 GGTTATCTGCAGGAGACGGCAGG No data
1177139417_1177139421 4 Left 1177139417 21:17342271-17342293 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 1177139421 21:17342298-17342320 GGTTATCTGCAGGAGACGGCAGG No data
1177139412_1177139421 25 Left 1177139412 21:17342250-17342272 CCACCAAAACCCAGTAACAGGCC No data
Right 1177139421 21:17342298-17342320 GGTTATCTGCAGGAGACGGCAGG No data
1177139414_1177139421 16 Left 1177139414 21:17342259-17342281 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1177139421 21:17342298-17342320 GGTTATCTGCAGGAGACGGCAGG No data
1177139413_1177139421 22 Left 1177139413 21:17342253-17342275 CCAAAACCCAGTAACAGGCCAAG No data
Right 1177139421 21:17342298-17342320 GGTTATCTGCAGGAGACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177139421 Original CRISPR GGTTATCTGCAGGAGACGGC AGG Intergenic
No off target data available for this crispr