ID: 1177147612

View in Genome Browser
Species Human (GRCh38)
Location 21:17423341-17423363
Sequence GCATCCAGGTAAGCTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177147606_1177147612 16 Left 1177147606 21:17423302-17423324 CCTGCTGGATCTCCTTGACTGCA No data
Right 1177147612 21:17423341-17423363 GCATCCAGGTAAGCTGCAGCTGG No data
1177147608_1177147612 4 Left 1177147608 21:17423314-17423336 CCTTGACTGCAAGATCCTTAGGT No data
Right 1177147612 21:17423341-17423363 GCATCCAGGTAAGCTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177147612 Original CRISPR GCATCCAGGTAAGCTGCAGC TGG Intergenic
No off target data available for this crispr