ID: 1177149121

View in Genome Browser
Species Human (GRCh38)
Location 21:17437034-17437056
Sequence ACTATTGCTTTCAGGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177149121_1177149124 18 Left 1177149121 21:17437034-17437056 CCAGGCTGCCTGAAAGCAATAGT No data
Right 1177149124 21:17437075-17437097 TGGATACTTTATCTGAGCAGCGG No data
1177149121_1177149123 -2 Left 1177149121 21:17437034-17437056 CCAGGCTGCCTGAAAGCAATAGT No data
Right 1177149123 21:17437055-17437077 GTGCTGTTTCAGTGCTACACTGG No data
1177149121_1177149125 19 Left 1177149121 21:17437034-17437056 CCAGGCTGCCTGAAAGCAATAGT No data
Right 1177149125 21:17437076-17437098 GGATACTTTATCTGAGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177149121 Original CRISPR ACTATTGCTTTCAGGCAGCC TGG (reversed) Intergenic