ID: 1177150385

View in Genome Browser
Species Human (GRCh38)
Location 21:17449798-17449820
Sequence GGGTGTTCCCAGAAGTGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177150381_1177150385 -3 Left 1177150381 21:17449778-17449800 CCCATTTTTACACCAAATATGGG No data
Right 1177150385 21:17449798-17449820 GGGTGTTCCCAGAAGTGTCATGG No data
1177150383_1177150385 -4 Left 1177150383 21:17449779-17449801 CCATTTTTACACCAAATATGGGT No data
Right 1177150385 21:17449798-17449820 GGGTGTTCCCAGAAGTGTCATGG No data
1177150379_1177150385 0 Left 1177150379 21:17449775-17449797 CCACCCATTTTTACACCAAATAT 0: 27
1: 40
2: 52
3: 105
4: 880
Right 1177150385 21:17449798-17449820 GGGTGTTCCCAGAAGTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177150385 Original CRISPR GGGTGTTCCCAGAAGTGTCA TGG Intergenic
No off target data available for this crispr