ID: 1177157243

View in Genome Browser
Species Human (GRCh38)
Location 21:17512605-17512627
Sequence GTGGGACGGGTGGGTGCAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 613}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177157223_1177157243 26 Left 1177157223 21:17512556-17512578 CCCGTGAGCATGAGGTCAGAGAA 0: 1
1: 0
2: 2
3: 26
4: 264
Right 1177157243 21:17512605-17512627 GTGGGACGGGTGGGTGCAGGCGG 0: 1
1: 0
2: 3
3: 52
4: 613
1177157234_1177157243 -3 Left 1177157234 21:17512585-17512607 CCTGGGGCAAACCGCGAGGGGTG 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1177157243 21:17512605-17512627 GTGGGACGGGTGGGTGCAGGCGG 0: 1
1: 0
2: 3
3: 52
4: 613
1177157228_1177157243 3 Left 1177157228 21:17512579-17512601 CCTGCCCCTGGGGCAAACCGCGA 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1177157243 21:17512605-17512627 GTGGGACGGGTGGGTGCAGGCGG 0: 1
1: 0
2: 3
3: 52
4: 613
1177157224_1177157243 25 Left 1177157224 21:17512557-17512579 CCGTGAGCATGAGGTCAGAGAAC 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1177157243 21:17512605-17512627 GTGGGACGGGTGGGTGCAGGCGG 0: 1
1: 0
2: 3
3: 52
4: 613
1177157231_1177157243 -1 Left 1177157231 21:17512583-17512605 CCCCTGGGGCAAACCGCGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1177157243 21:17512605-17512627 GTGGGACGGGTGGGTGCAGGCGG 0: 1
1: 0
2: 3
3: 52
4: 613
1177157233_1177157243 -2 Left 1177157233 21:17512584-17512606 CCCTGGGGCAAACCGCGAGGGGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1177157243 21:17512605-17512627 GTGGGACGGGTGGGTGCAGGCGG 0: 1
1: 0
2: 3
3: 52
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177157243 Original CRISPR GTGGGACGGGTGGGTGCAGG CGG Exonic