ID: 1177157348

View in Genome Browser
Species Human (GRCh38)
Location 21:17512980-17513002
Sequence CCTGCCGAGCGGGGGCTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 346}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177157339_1177157348 3 Left 1177157339 21:17512954-17512976 CCGCTGCCGGAAGTGACGCGAGT 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1177157348 21:17512980-17513002 CCTGCCGAGCGGGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 346
1177157336_1177157348 13 Left 1177157336 21:17512944-17512966 CCGGCCCGGGCCGCTGCCGGAAG 0: 1
1: 0
2: 3
3: 10
4: 186
Right 1177157348 21:17512980-17513002 CCTGCCGAGCGGGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 346
1177157340_1177157348 -3 Left 1177157340 21:17512960-17512982 CCGGAAGTGACGCGAGTTCACCT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1177157348 21:17512980-17513002 CCTGCCGAGCGGGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 346
1177157331_1177157348 27 Left 1177157331 21:17512930-17512952 CCGGCGCTCGCAGCCCGGCCCGG 0: 1
1: 0
2: 1
3: 45
4: 325
Right 1177157348 21:17512980-17513002 CCTGCCGAGCGGGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 346
1177157337_1177157348 9 Left 1177157337 21:17512948-17512970 CCCGGGCCGCTGCCGGAAGTGAC 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1177157348 21:17512980-17513002 CCTGCCGAGCGGGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 346
1177157338_1177157348 8 Left 1177157338 21:17512949-17512971 CCGGGCCGCTGCCGGAAGTGACG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1177157348 21:17512980-17513002 CCTGCCGAGCGGGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 346
1177157335_1177157348 14 Left 1177157335 21:17512943-17512965 CCCGGCCCGGGCCGCTGCCGGAA 0: 1
1: 0
2: 0
3: 19
4: 224
Right 1177157348 21:17512980-17513002 CCTGCCGAGCGGGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177157348 Original CRISPR CCTGCCGAGCGGGGGCTGGG AGG Exonic
900096048 1:940505-940527 CCTGCATAGTGGGGGCTGCGGGG + Intronic
900253413 1:1683702-1683724 CCTGGAGAGCGGGGGTAGGGGGG - Intronic
900400176 1:2469782-2469804 CCTCCCGTGTGGGGGCAGGGTGG + Intronic
900493124 1:2962755-2962777 GCTGCTGAGAGGGCGCTGGGAGG + Intergenic
900648034 1:3717839-3717861 CCAGCCGGGCCGGAGCTGGGTGG - Intronic
900759877 1:4463420-4463442 CCTTCCTAGCTGGGGCTGGTGGG + Intergenic
900796074 1:4709204-4709226 CCTGCCTGGTGGGGGCTGGTGGG + Intronic
901066594 1:6497335-6497357 CGTGCCGCGCGGGGGGCGGGCGG + Intronic
903125204 1:21243065-21243087 CCTGCAGAGCAGAGGCTGAGTGG + Intronic
903190215 1:21652015-21652037 CCGGCCGGGCGGGGGCTTCGCGG + Intronic
903438716 1:23371140-23371162 CCTGCGGGGCGGGGGCGGGGTGG + Exonic
904289017 1:29471710-29471732 CCTGCTGGGTGGGGGCTGGATGG - Intergenic
904676294 1:32201110-32201132 CCAGCCGACCGGAGGCTTGGGGG + Intronic
905206195 1:36344091-36344113 CCTGCCTCCCGGGGGGTGGGGGG - Intronic
905478327 1:38244403-38244425 CCTGCCGTGCGGGGGAGGGGCGG - Intergenic
906436832 1:45803643-45803665 CCTGCCCAACGTGTGCTGGGTGG + Exonic
910676621 1:89821800-89821822 CCCGGCGGGCGGGGGCGGGGAGG + Intronic
911689814 1:100820353-100820375 CCTGCAAAGCGGGAGCTTGGCGG + Intergenic
914750936 1:150534511-150534533 TCTCCTGAGTGGGGGCTGGGGGG - Intergenic
917660438 1:177172099-177172121 CCTGCCCAGCTGACGCTGGGAGG + Intronic
917962220 1:180154550-180154572 CCCGCCGAGCGGTCGCTGCGGGG - Intergenic
920446294 1:206021232-206021254 CCTGCCGCTGTGGGGCTGGGTGG - Intronic
920822985 1:209398686-209398708 CCTGCAGGGCTGGGGCAGGGCGG - Intergenic
922611282 1:226930666-226930688 CCTGGGGAGAGGGAGCTGGGGGG + Intronic
923030856 1:230248099-230248121 CCTGCAGTGAGGGAGCTGGGAGG + Intronic
923140888 1:231161275-231161297 GCTGCCGAGGGAAGGCTGGGTGG - Intergenic
923712124 1:236395859-236395881 CCTGGCGAGCGCGGGAGGGGCGG - Intronic
923728069 1:236524226-236524248 GCGGCAGAGCCGGGGCTGGGTGG + Intronic
924531504 1:244897584-244897606 CCGGCAGGGCGGGGGCAGGGTGG + Intergenic
1062857512 10:786645-786667 CCTGTGGTGCGGGGGCGGGGTGG + Intergenic
1062932168 10:1360621-1360643 ACAGCTGGGCGGGGGCTGGGAGG - Intronic
1063596635 10:7441475-7441497 ACTGCACAGCTGGGGCTGGGAGG - Intergenic
1063662398 10:8043579-8043601 CCTGACGAACGGGGTCGGGGGGG - Intergenic
1064680754 10:17809049-17809071 CCTGCTCAGATGGGGCTGGGTGG - Intergenic
1066080813 10:31928871-31928893 CGTGACGCGCGGGGGCGGGGCGG + Intronic
1068544119 10:58327209-58327231 CCTGGCGAACCGAGGCTGGGAGG + Intergenic
1069187511 10:65443714-65443736 ACTGCAGAGTGGAGGCTGGGAGG + Intergenic
1069582086 10:69573139-69573161 CTGACCCAGCGGGGGCTGGGAGG - Intronic
1069619218 10:69826203-69826225 CCCGCCACGCTGGGGCTGGGTGG + Intronic
1071334192 10:84588363-84588385 CCTGCTGAGTGGGGGCTGCAGGG - Intergenic
1073363568 10:102918868-102918890 CCGGGGGAGCGCGGGCTGGGGGG + Exonic
1074360004 10:112818073-112818095 GCTGCCGGGCCTGGGCTGGGAGG + Exonic
1074830165 10:117241962-117241984 GCTGCCGCGCCGGGGCTAGGAGG + Intronic
1075233258 10:120702804-120702826 CCTGCCAAGCGTGGGCTGGTAGG + Intergenic
1075522527 10:123151472-123151494 GCGGCCGCGCAGGGGCTGGGAGG + Intergenic
1076797987 10:132808014-132808036 CCGGATGAGTGGGGGCTGGGGGG - Intergenic
1076895733 10:133310468-133310490 CCTGCCGAAGGGAGGCTGGAGGG + Intronic
1077051441 11:568648-568670 CCTGCCGGGCGGGGCCTGCGGGG + Intergenic
1077233267 11:1468178-1468200 GCTGCCGAGCGGAGGCTGGGTGG - Intergenic
1077313353 11:1903310-1903332 GCTGTGGAGCGGGGGGTGGGGGG + Intergenic
1077997947 11:7469929-7469951 CCTGCAATGCGGGGGGTGGGAGG + Intergenic
1079279258 11:19073068-19073090 CCTGCGGAGCATGGGCTTGGAGG - Intergenic
1080386947 11:31816058-31816080 CCTGAGGAGCGGGGTCTGGCCGG - Intronic
1080475228 11:32583994-32584016 GCTGCCGAGCCTGGGCCGGGCGG + Intronic
1080592594 11:33736524-33736546 CCTGCCGAGGTGCGGCTGCGCGG - Intergenic
1083596259 11:63919426-63919448 CCTGCCGCCCCGGGGCTGCGGGG + Intergenic
1083876078 11:65525081-65525103 CCGCCCGAGCCGGGGCGGGGCGG - Exonic
1084119176 11:67058977-67058999 CCTGATGGGCGGGGGCTGGAGGG + Intronic
1084153453 11:67301857-67301879 CCCGCCAAGCCAGGGCTGGGGGG - Intronic
1084752764 11:71214928-71214950 CCTGCCGAGAGGAGGATGTGTGG - Intronic
1084934245 11:72578638-72578660 ACTGCCAAGCTGGGGCTGGTGGG - Intronic
1085056275 11:73405924-73405946 CCTGCCAAGCGGCTGCAGGGTGG - Intronic
1085607106 11:77911073-77911095 CCTGCCGAGCATGAGATGGGAGG - Intronic
1086561631 11:88175492-88175514 GCGGCGGGGCGGGGGCTGGGGGG + Intergenic
1089067797 11:115675073-115675095 CCTGCAGAGGGGAGGGTGGGTGG + Intergenic
1090240967 11:125181584-125181606 GCTGCCCAGTGAGGGCTGGGAGG + Intronic
1091207846 11:133833336-133833358 GCTGCCGGGCGGAGGCGGGGTGG + Intergenic
1092262538 12:6960243-6960265 CGTGCAGAGCAGGGCCTGGGGGG + Intronic
1094523967 12:31219673-31219695 CCTGCAGAGCAGGGGGTTGGAGG - Intergenic
1096647640 12:53047338-53047360 CCGGCCGGGCGGGGGCGCGGCGG - Intronic
1098819397 12:75209065-75209087 CCTGGGGAGAGGTGGCTGGGAGG - Intronic
1100447979 12:94678650-94678672 CCAGCAGGGCGGGGGTTGGGTGG + Intergenic
1100476683 12:94941531-94941553 ACTGCTGAGCAGGGGCTGGCTGG + Intronic
1101466910 12:104958329-104958351 GCTGCCGCGCGGGGGCGGGGCGG - Intronic
1102053756 12:109880843-109880865 CCTGGGGAGCGTTGGCTGGGTGG - Intergenic
1102206728 12:111096124-111096146 CCTGCTGATGGGGGGCTCGGTGG - Intronic
1102460731 12:113098041-113098063 CCTGCCAAGAGAGGGGTGGGTGG + Intergenic
1102505964 12:113384829-113384851 CCTGCCGGGCAGGGGAAGGGAGG - Exonic
1102950643 12:117028511-117028533 CCTGCAGGGCTGGAGCTGGGAGG - Exonic
1103779432 12:123389198-123389220 CCGGCCGCGCGGGGGGCGGGCGG + Intronic
1103782631 12:123409163-123409185 CCAGGCTAGCGGGGGGTGGGAGG - Exonic
1103856319 12:123973093-123973115 CCGACCGGGCCGGGGCTGGGGGG + Intronic
1105537968 13:21287608-21287630 TGGGCCGGGCGGGGGCTGGGAGG - Intergenic
1108053450 13:46465669-46465691 CCTGCCTCGTGGGGGGTGGGGGG - Intergenic
1112562340 13:100525801-100525823 CCTGCAGAGGAAGGGCTGGGTGG + Intronic
1113902242 13:113803798-113803820 CCTGCCCAGCGGGCACTGGAAGG - Intronic
1118736331 14:68704253-68704275 CCTCCCCAGTGGGGGCTGCGGGG - Intronic
1120789236 14:88563524-88563546 TCCCCCGGGCGGGGGCTGGGAGG - Intronic
1121454110 14:94027412-94027434 CCTGTGGAGTGAGGGCTGGGTGG + Intronic
1121473345 14:94173968-94173990 GCTGGGGGGCGGGGGCTGGGGGG - Intronic
1121629733 14:95413500-95413522 CCTGCCTTGCAGGGGATGGGAGG - Intronic
1121790119 14:96692890-96692912 CCTGCCCATCGGGGGCTCAGAGG - Intergenic
1122268294 14:100556890-100556912 CCTGCAGAGAGGGGGCATGGAGG - Intronic
1122410157 14:101521658-101521680 CCTGCCGTGGGAGGGCTGGCGGG - Intergenic
1122634360 14:103123273-103123295 CCTGCCCAGCGGGGGATGCGGGG - Intergenic
1122739919 14:103866328-103866350 CCAGCTGGGCGGGGGCTGCGGGG + Intergenic
1122887618 14:104717362-104717384 CCTGCCCGGGGGGGACTGGGAGG - Intronic
1122917325 14:104865193-104865215 GCGGCCGGGCGGGGGCGGGGCGG + Intergenic
1122924519 14:104893437-104893459 CCTGCCGGGCCGGAGCAGGGAGG + Intronic
1123028611 14:105440142-105440164 CCTGCCCAGCAGGGGCAGTGAGG - Intronic
1123048115 14:105528155-105528177 GCTGCCGGGCAGGGGCGGGGAGG + Intronic
1123071176 14:105643171-105643193 CCTGGGGAGCGGGGGCTTGCCGG + Intergenic
1123090836 14:105741441-105741463 CCTGGGGAGCGGGGGCTTGCCGG + Intergenic
1123687599 15:22810173-22810195 CCTGCCCTGCGTGGGATGGGTGG + Intronic
1124239341 15:28017054-28017076 CCTGGGGAGCGGGGGGCGGGGGG + Intronic
1124369301 15:29094372-29094394 CCTGGGCAGTGGGGGCTGGGGGG + Intronic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1128606489 15:69040069-69040091 CCTGCTGGGCTGGGTCTGGGAGG - Intronic
1128717607 15:69920066-69920088 CCTGCCAAGCTGGGGCACGGAGG + Intergenic
1129393553 15:75232589-75232611 CTTGGGGAGCTGGGGCTGGGTGG + Intergenic
1129535962 15:76313872-76313894 TCTGCCCAGTGGGGGCAGGGCGG - Intergenic
1129700129 15:77763048-77763070 CCAGCCGGGCGAGGGCGGGGTGG - Intronic
1129908886 15:79209697-79209719 ACTGCAGAGAGGGGGCGGGGAGG + Intergenic
1130302319 15:82689332-82689354 CCCTCCGGGCGGGGCCTGGGTGG - Intronic
1130335297 15:82952719-82952741 GCGGGCGGGCGGGGGCTGGGCGG + Exonic
1130990682 15:88873978-88874000 CCAGCCCAGCGGGCACTGGGAGG + Exonic
1131150475 15:90044375-90044397 CCTGCCAAGGCGGGGCTAGGTGG + Intronic
1132584645 16:700891-700913 CCTGCTGAGCGGGGGCTGCCGGG - Intronic
1132590343 16:723751-723773 CCTGTCTGGCGGGGGCTTGGTGG + Intronic
1132601532 16:775142-775164 CCTGCCTGGTGGGCGCTGGGTGG - Exonic
1132672970 16:1109278-1109300 CCTGAAGGCCGGGGGCTGGGGGG + Intergenic
1132783751 16:1642903-1642925 GCTGCCCAGCGGGGGCGTGGTGG + Intronic
1132862926 16:2080331-2080353 CCTGCTGACCCAGGGCTGGGCGG + Exonic
1133005958 16:2882226-2882248 CCTGCAGAGCCAGGGCCGGGAGG + Intergenic
1133220188 16:4316317-4316339 CCTGTCGCGCCGGGGCTGCGGGG + Intronic
1133977747 16:10612206-10612228 CCTACAGAGCTGGGGCTGTGGGG - Intergenic
1136267621 16:29130602-29130624 CCTGGCGAGGGGCGGCAGGGCGG + Intergenic
1136513924 16:30756517-30756539 CCTGGTGAGCGGGGGCTGAGAGG + Exonic
1138420066 16:56893081-56893103 CCTGCCCGGCGGGGGCGGGGTGG + Intronic
1138599698 16:58047137-58047159 CCTGCCGGGGTGGGGCAGGGAGG + Intergenic
1139493915 16:67302284-67302306 CCGGCCGAGCCTGGGCTGGCGGG + Intronic
1139547981 16:67658606-67658628 CCTGCAGAGCCGGGTCTGGTGGG + Exonic
1141699300 16:85635123-85635145 CCTGACCAGGGCGGGCTGGGGGG + Intronic
1142070925 16:88090946-88090968 CCTGGCGAGGGGCGGCAGGGCGG + Intronic
1142112950 16:88341794-88341816 CATGCCCAGTGGGGGCTGGGCGG + Intergenic
1142196912 16:88743178-88743200 GCTGCAGGGCAGGGGCTGGGCGG + Intronic
1142235643 16:88921376-88921398 CCTGCCAAGCTGGGGTGGGGCGG - Intronic
1142390812 16:89798611-89798633 GCTGAGGAGTGGGGGCTGGGTGG - Intronic
1142611258 17:1110060-1110082 CCTGCGGTGGGGTGGCTGGGGGG - Intronic
1142713972 17:1738058-1738080 AGTGCCCAGCGGGGGCTGAGGGG - Exonic
1143410199 17:6704056-6704078 CCTGCAGAGGAGGGGCAGGGAGG + Exonic
1144778729 17:17797468-17797490 CCTGCCCTCCGGGGGCTGGGAGG - Exonic
1145273945 17:21418960-21418982 CCCGCAGGGTGGGGGCTGGGAGG - Exonic
1147159392 17:38561649-38561671 ACTGGCGAGCCGCGGCTGGGCGG + Exonic
1147436840 17:40421576-40421598 CCTGCAGAGTGGGGGCAGGGTGG - Intergenic
1147916529 17:43890893-43890915 CTTGCTTAGCTGGGGCTGGGTGG - Intronic
1148093772 17:45038624-45038646 CCTGCAGAATGGGGGCTGAGGGG + Intronic
1148339163 17:46863162-46863184 CTTCCCAAGCTGGGGCTGGGCGG - Intronic
1148749297 17:49935494-49935516 CCTGCCCAGGGTGGTCTGGGGGG - Intergenic
1148821751 17:50364027-50364049 CCTTCAGAGCAGGGGTTGGGGGG - Intergenic
1148848445 17:50542212-50542234 CCTCCGGACCCGGGGCTGGGCGG + Exonic
1149599788 17:57885803-57885825 CGGGCCGTGCTGGGGCTGGGCGG + Exonic
1151591476 17:75047341-75047363 CCAGCCGGGCGTGGGCTGGGGGG - Exonic
1152287315 17:79420652-79420674 GCTGCAGAGCAGTGGCTGGGAGG - Intronic
1152291423 17:79442119-79442141 CCTGCTGAGCCTGGCCTGGGAGG + Intronic
1152644621 17:81463078-81463100 CCTGCTGAGCGGGGGCTGTGTGG - Intronic
1152924094 17:83079728-83079750 CGAGCCGGGCGGGGGCGGGGCGG - Exonic
1153151811 18:2104807-2104829 CCTGGTGAGCCGGGGATGGGAGG - Intergenic
1153815274 18:8785435-8785457 CCTCCCCAGCGGCGGCAGGGCGG - Intronic
1153944985 18:10010098-10010120 CCTGGTCAGCGGGGGCTGTGGGG + Intergenic
1154145302 18:11861676-11861698 CCTTCCGAGAGGGAGCTGGGAGG - Intronic
1154196641 18:12271871-12271893 CTCGCCGGGCGGGGGCTGCGGGG - Intronic
1154377348 18:13821266-13821288 CCTGCGGAGGGAGGGATGGGAGG - Intergenic
1156259922 18:35436778-35436800 CCCGGGGAGTGGGGGCTGGGAGG + Intergenic
1157276214 18:46312759-46312781 CCTGCCCAGGGGAGGCTGGCAGG + Intergenic
1157589649 18:48828798-48828820 CCTGGCGAGTGGGGGCAGTGAGG + Intronic
1158227394 18:55215273-55215295 CCTGCGGAGGAAGGGCTGGGTGG - Intergenic
1158357657 18:56638679-56638701 CCTGCCGCGCGGTGGCTGCTGGG - Intronic
1158954745 18:62526787-62526809 CTTGCAGGGCGGGGGCGGGGAGG - Intronic
1159010676 18:63056628-63056650 CCTGTCAAGTTGGGGCTGGGTGG - Intergenic
1160175731 18:76592558-76592580 ACGGCCCAGAGGGGGCTGGGGGG - Intergenic
1160535368 18:79588769-79588791 CCCTCCGTGCAGGGGCTGGGAGG - Intergenic
1160566298 18:79788458-79788480 GCGGCGGAGCGGGGGCTGTGCGG - Intergenic
1160761720 19:788866-788888 CCTGCAGAGTGGGGGTGGGGCGG - Intergenic
1160794936 19:940905-940927 CCTGGCGGGCGAGGGGTGGGTGG + Intronic
1160798556 19:956742-956764 CCTTCCGGGAAGGGGCTGGGGGG - Intronic
1160807769 19:1000265-1000287 CCTGCCCAGGGCGGGATGGGGGG - Intergenic
1160873058 19:1285794-1285816 CCGGCCGCGCGGGGACTGGGCGG - Intergenic
1160981025 19:1816644-1816666 CCTGGGGAGAGGCGGCTGGGAGG + Intronic
1161403215 19:4078056-4078078 CCTGCCGGGCTTGGGCTGCGGGG + Intergenic
1161742622 19:6032613-6032635 CCTGCCAAGTGGGAGTTGGGAGG - Intronic
1161852786 19:6746237-6746259 CCTGCCCAGCGGCGGGTGGCGGG + Intronic
1162909729 19:13842499-13842521 CCTACGGAGCGGGGGAAGGGCGG - Intergenic
1163034167 19:14561971-14561993 TGTGCAGGGCGGGGGCTGGGAGG + Intronic
1163534402 19:17868928-17868950 GCTGCCGAGTGGGGGGAGGGGGG - Intergenic
1163630938 19:18417664-18417686 CCCGCCGAGCCGGGGCCCGGAGG + Intergenic
1164595495 19:29528758-29528780 CCCGCAGAGCGGAGGCTGGCAGG - Intronic
1164693063 19:30225459-30225481 CCAGCCCAGCCGGGGCAGGGCGG - Intergenic
1165460266 19:35940102-35940124 CCTGGCGAGCAGGGGCAGGCGGG - Exonic
1166215332 19:41331020-41331042 CCTGCCGGGGCGGGGCGGGGCGG + Exonic
1166345297 19:42161833-42161855 GCTCCAGGGCGGGGGCTGGGGGG - Intronic
1167072987 19:47231249-47231271 CCCGCCGGGCGGGGGCGGGGCGG - Intronic
1167292233 19:48630650-48630672 CCTCCCTTGCGGGGGCGGGGAGG - Exonic
1167532218 19:50025206-50025228 CCGGCCGAGCTGCGGCTAGGGGG + Intronic
1168151759 19:54452824-54452846 TCTGCCGGGATGGGGCTGGGTGG + Intronic
1168165573 19:54545210-54545232 GCGGGCGAGCGGGGGCAGGGCGG - Intronic
925151695 2:1619428-1619450 GCGGCTGAGCGGGGGCTGGAGGG - Intergenic
925151707 2:1619471-1619493 GCGGCTGAGCGGGGGCTGGAGGG - Intergenic
926126746 2:10276880-10276902 CCAGCCGAGGGGGCGGTGGGTGG + Intergenic
929941895 2:46340387-46340409 CCAGCGGAGCGGAGGTTGGGAGG + Intronic
930019841 2:46994879-46994901 CCTGCAGTGCTGGTGCTGGGAGG + Intronic
930338782 2:50084511-50084533 CCTGGTGAGCGTGGGCTTGGTGG - Intronic
932234349 2:70109070-70109092 CCAGCGGGGCGGGGCCTGGGTGG + Intergenic
932496094 2:72146484-72146506 ACAGCGGAGCGGGGGCGGGGAGG - Intronic
933983952 2:87575295-87575317 CCTGCTTTGCTGGGGCTGGGGGG + Intergenic
936154712 2:110040364-110040386 CCAGCTGAGCAGGGGATGGGGGG + Intergenic
936189971 2:110331050-110331072 CCAGCTGAGCAGGGGATGGGGGG - Intergenic
936291590 2:111228469-111228491 CCTGGGGAGCTGGGGTTGGGAGG - Intergenic
936309903 2:111375501-111375523 CCTGCTTTGCTGGGGCTGGGGGG - Intergenic
936945989 2:117931437-117931459 ACTGCCGGGTGGGGGATGGGGGG - Intronic
937059022 2:118967699-118967721 CCTGCTGTGCGGGGGTTGGAAGG + Intronic
938213004 2:129484386-129484408 CCTGAGGAGCAGGGGCTGGATGG - Intergenic
938415985 2:131104103-131104125 CCAGCCTAGCAGGGGTTGGGGGG - Intergenic
945988391 2:216372358-216372380 CGTGACGCGCGGGGTCTGGGTGG - Intergenic
946408453 2:219505031-219505053 CCACCCAAGTGGGGGCTGGGTGG + Intronic
947535978 2:230940685-230940707 CCTGCCCAGCTGGGGCGAGGCGG - Intronic
947860586 2:233354758-233354780 CGGGCCGAGCCGGGCCTGGGCGG - Intronic
948459824 2:238123734-238123756 CCTCCGGGGCTGGGGCTGGGCGG + Intronic
948963312 2:241356601-241356623 CCTGCCGCGTGGGGGCAGGCGGG + Intronic
949026404 2:241768306-241768328 CCTGGGGAGCAGGCGCTGGGTGG + Exonic
949048308 2:241882311-241882333 CCTGGTGAGAGGTGGCTGGGAGG + Intergenic
1169215900 20:3794795-3794817 CCTGGTGATGGGGGGCTGGGTGG - Intronic
1170696313 20:18662410-18662432 CATGCCCAGCTGGGGGTGGGGGG + Intronic
1171216526 20:23356450-23356472 CCTGCCGAACGGCCGCTTGGTGG - Intergenic
1171260045 20:23724142-23724164 CCTGTCCAGCAGGGGCTGTGGGG - Intergenic
1171269116 20:23799675-23799697 CCTGTCCAGCAGGGGCTGTGGGG - Intergenic
1171456705 20:25276485-25276507 GGTGCCGAGCATGGGCTGGGTGG + Intronic
1172846271 20:37931523-37931545 CCTGCACGGCGGGGGATGGGTGG - Intronic
1173279693 20:41617898-41617920 CCAGCCGCGCTGGGGCGGGGCGG - Intronic
1173918386 20:46726182-46726204 CCAGCCGAGGAGGGGCTGAGGGG - Exonic
1174210791 20:48876272-48876294 CCTGCCCACCTGAGGCTGGGTGG - Intergenic
1175267141 20:57709781-57709803 GCTGCCGAGGGGAGGCCGGGGGG - Exonic
1175439631 20:58981529-58981551 CCGGGCGGGCGGGGGCGGGGCGG - Intronic
1175877760 20:62238537-62238559 CCTACGGGGCGGGGGCGGGGCGG + Exonic
1175952751 20:62592167-62592189 CCTGCAGAGAGTGAGCTGGGAGG + Intergenic
1176146512 20:63567935-63567957 CCTGCCCAGTGGGGAGTGGGAGG - Intronic
1177157348 21:17512980-17513002 CCTGCCGAGCGGGGGCTGGGAGG + Exonic
1177580983 21:23021634-23021656 CCGGGTGAGCGGGGGCTTGGCGG - Intergenic
1179540245 21:42079160-42079182 CCTGCAGAGCGGGAGCAGGAAGG - Intronic
1179559279 21:42202529-42202551 GCTGCCGAGAGAGGGATGGGGGG - Intronic
1179948914 21:44698605-44698627 CCTGCCAAGTGGGGGCTGGCTGG + Intronic
1179987978 21:44931862-44931884 TCTCCCTAGCGGAGGCTGGGCGG + Intronic
1180004611 21:45014569-45014591 CCCGCCGAGCAGGGCCTGGTTGG + Intergenic
1180025837 21:45161579-45161601 CCTGCCGAGGGGCGGCTGCAAGG - Intronic
1180158587 21:45989334-45989356 CCTGCCAGGGAGGGGCTGGGTGG + Intronic
1180163110 21:46006810-46006832 CATGCCTGGCAGGGGCTGGGAGG + Intergenic
1181047437 22:20222235-20222257 CATGCACAGCGGGGGCTAGGCGG + Intergenic
1181068957 22:20320629-20320651 GCTGCTGGGCCGGGGCTGGGGGG + Intergenic
1182297510 22:29318475-29318497 CCTCCCGACAGGGGGCTGAGTGG - Intronic
1183588899 22:38768850-38768872 CCTGCTGGGAGGGTGCTGGGGGG - Intronic
1183608773 22:38883405-38883427 CCTGACAAGGGGGTGCTGGGAGG + Intergenic
1183743722 22:39681713-39681735 CCTGCCCTGCTGGGGGTGGGGGG + Intronic
1184459302 22:44628098-44628120 CCTGCAGAGGGGGCTCTGGGAGG - Intergenic
1184663811 22:45977320-45977342 CCTGGGGAGGGGGGGCCGGGGGG - Intergenic
1184711045 22:46249762-46249784 GTTGGGGAGCGGGGGCTGGGGGG + Intronic
1185219760 22:49623459-49623481 CCTGCCCAGCGGGGGCTCTGGGG - Intronic
1185270776 22:49928595-49928617 CCAGAGGGGCGGGGGCTGGGTGG + Intergenic
951932692 3:27986362-27986384 ACTGCCAAGCTTGGGCTGGGAGG + Intergenic
952451777 3:33440115-33440137 CTAGCGGCGCGGGGGCTGGGCGG - Exonic
953319751 3:41961558-41961580 CCTGGGGAGCGGGGGGGGGGGGG - Intronic
953457704 3:43055837-43055859 CCTGCCAAGAGTGAGCTGGGAGG - Intronic
954121820 3:48504187-48504209 CCAGCCGGGCCGGGGCGGGGCGG - Exonic
954613626 3:51958771-51958793 CCTGGTGAGCGCGGGCTGGGCGG - Exonic
956675015 3:71725266-71725288 CAGGCCGAGCGGCGGCTCGGGGG + Exonic
957917872 3:86709163-86709185 CCTGCCGAGCCCGGCATGGGAGG + Intergenic
960971061 3:123140600-123140622 CCATCAGAGCAGGGGCTGGGAGG + Intronic
961532562 3:127548085-127548107 CCAGCCGAGTGCGGGCAGGGCGG - Intergenic
963040444 3:141066165-141066187 CCGGCCAAGCGGGAGCTGCGGGG + Exonic
963162139 3:142161733-142161755 GCTGCAGAGGTGGGGCTGGGTGG + Intergenic
965390205 3:168095439-168095461 CGCGCCGCGCGGGGGCTGAGCGG - Exonic
966411832 3:179653089-179653111 CCGGCCGAGCCGGGGCGGGCGGG - Exonic
966594419 3:181712774-181712796 CATGGCGAGCGGGGTCGGGGTGG + Exonic
968454119 4:688640-688662 CCTGCTGTCCTGGGGCTGGGAGG + Intronic
968642434 4:1721362-1721384 GCGCCCGAGCGGGGGGTGGGGGG + Intergenic
968803262 4:2756483-2756505 CCGGGCGAGAAGGGGCTGGGCGG - Intergenic
968965743 4:3768255-3768277 CCTGCCGAGGTGTGGCTGTGAGG + Exonic
969318434 4:6395883-6395905 CCTGCAGAGAGGGGGCCTGGGGG - Intronic
969568772 4:7995842-7995864 GGTGCCGAGGAGGGGCTGGGAGG - Intronic
969607605 4:8210310-8210332 CCTCCCCAGCGGGGGGTTGGGGG - Intronic
972437049 4:39044770-39044792 CCTGGCGGGAGGGGGCGGGGCGG + Intergenic
973590653 4:52437368-52437390 CCTGCCTAGCAGGAGATGGGAGG + Intergenic
981713558 4:147732020-147732042 TCTGCCGCGCGGGGGCCGGGCGG + Intergenic
982198490 4:152937630-152937652 CCTGCGGGGCGGGGACTGCGGGG - Intronic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
983940221 4:173529393-173529415 CCGGGCGCCCGGGGGCTGGGGGG - Exonic
984639279 4:182144587-182144609 CCGGCGGGGCGGGGGCGGGGAGG - Intronic
984923407 4:184785591-184785613 CCTCCTGGGCGGGGGCGGGGGGG + Intronic
985111936 4:186555312-186555334 CCCGCGGAGCACGGGCTGGGAGG + Exonic
985520833 5:373370-373392 CAGGCCGGGCGGTGGCTGGGAGG + Intronic
985693572 5:1327056-1327078 CCTGTCGAGGAGGAGCTGGGTGG - Intronic
985731444 5:1551524-1551546 CCTGCCGTGCTGGAGCTGGCTGG + Intergenic
988796581 5:34657229-34657251 CCTGCCTGGTGGGGGGTGGGGGG + Intronic
991041650 5:62182514-62182536 CCTGCCCATGGGGGCCTGGGAGG - Intergenic
992549101 5:77844729-77844751 CCAGCGGCGCGGGGGCTGTGGGG + Intronic
993733089 5:91445658-91445680 CCTGCAGGGCGGGGGGGGGGGGG - Intergenic
997321587 5:132983028-132983050 CCTTCCGAGAGGGAGGTGGGGGG - Intergenic
997426442 5:133805940-133805962 CCTTCTGATCGGGGGTTGGGGGG - Intergenic
998137016 5:139679191-139679213 CCTGCAGAGTAGGGCCTGGGTGG - Intronic
998165397 5:139839783-139839805 CCTGCGGTGGGGTGGCTGGGGGG + Intronic
998814607 5:146000236-146000258 CCTGCAGAGCGGGGGCGGCTGGG - Exonic
999809557 5:155114888-155114910 CCGGGTGAGCGTGGGCTGGGCGG + Intergenic
1002186341 5:177456487-177456509 CCCGCCAGGCGGGGGCGGGGTGG - Intergenic
1002296254 5:178232831-178232853 CCTGCGGGGCGGGGCCTGCGGGG - Intergenic
1002319312 5:178365622-178365644 CATGCCTGGCGGGTGCTGGGCGG - Intronic
1003187894 6:3849146-3849168 CCTGCCCAGCCGTGGCTGGCCGG - Intergenic
1003268721 6:4589030-4589052 GCTCCCGAGCTGGGGGTGGGGGG - Intergenic
1004426396 6:15510109-15510131 CCTGGGGGGCGGGGGCTGTGGGG + Intronic
1005288998 6:24360002-24360024 CCGGCCGCGCGGGGGCGGGGCGG + Intergenic
1005385250 6:25279307-25279329 CCTGCCGGGCTCCGGCTGGGCGG - Intronic
1006717689 6:36130756-36130778 CCAGCCCAGGGCGGGCTGGGCGG - Intronic
1008545122 6:52577122-52577144 CGGGCTGGGCGGGGGCTGGGCGG - Intergenic
1013631855 6:111993478-111993500 CCTGCCACGTGGGGGCTGAGAGG + Intergenic
1015904989 6:138107543-138107565 CCTGCCGGGCCGGGGCGGGCGGG + Intergenic
1017728209 6:157290803-157290825 CCTGCAGAGGGGAGGCTGGCAGG - Exonic
1018748733 6:166782745-166782767 CGGGCTGAGCTGGGGCTGGGAGG - Intronic
1018748916 6:166784937-166784959 CGGGCTGAGCTGGGGCTGGGAGG + Intronic
1018876733 6:167827452-167827474 CGGGCCGAGCGGGGGCTGGCGGG + Intronic
1018910133 6:168096969-168096991 CCTGGAGAGTGGGGGGTGGGGGG + Intergenic
1019112175 6:169724701-169724723 CCGGCAGAGAGGGGGCGGGGCGG - Intronic
1019512119 7:1422804-1422826 CCTGCCAAGCGGGGGTGGCGAGG - Intergenic
1019595491 7:1856474-1856496 GCTGGCCAGCGGGGGCTGTGGGG - Intronic
1019642101 7:2109044-2109066 GCTGCAGAGCGGGTGCGGGGAGG - Intronic
1023057584 7:36302370-36302392 GCTGCTGAACCGGGGCTGGGAGG + Intergenic
1024964023 7:55005609-55005631 CCTGTCCTGCGCGGGCTGGGGGG - Intergenic
1028417451 7:90595915-90595937 CCTCCCGCGCGCGGGCGGGGCGG + Intronic
1031878477 7:127168848-127168870 CCTGTCGGGTGGGGGCTGAGGGG + Intronic
1032386674 7:131530152-131530174 CCTGGAGAGCTGGGGGTGGGGGG - Intronic
1033388123 7:140899212-140899234 CCTGCCGGGAGTGGGCTGAGGGG - Intronic
1034330690 7:150279686-150279708 CCTGCAGAGCTGGGGGTGGGTGG - Intronic
1034618165 7:152436249-152436271 CCTGACGCGCGGGGGAGGGGCGG - Intergenic
1034667353 7:152830163-152830185 CCTGCAGAGCTGGGGGTGGGTGG + Intronic
1034962742 7:155372700-155372722 CCTGCCGACCGCGCGCTGCGGGG + Intergenic
1035051489 7:156001450-156001472 CCTGCCGAGCTGGGGCAAGCAGG - Intergenic
1036733380 8:11285079-11285101 CCTGCGGAGCTGGGGTGGGGCGG - Intronic
1037680881 8:21096575-21096597 CCTGGAGAACGGGGGGTGGGGGG - Intergenic
1037914087 8:22761377-22761399 CATGGCGAGGGGAGGCTGGGGGG + Intronic
1039904176 8:41774104-41774126 CCTGCCCAGGGGGTCCTGGGTGG - Intronic
1039910706 8:41824867-41824889 GCTGCAGAGCTGGGGCTGGCTGG + Intronic
1039953635 8:42191094-42191116 ACAACCTAGCGGGGGCTGGGGGG - Intronic
1039988629 8:42468735-42468757 GCTGCCGGGCGGGGGTGGGGTGG + Intronic
1040559897 8:48514735-48514757 CCTGGCGTCCGGGGGCTGGCAGG + Intergenic
1042656390 8:71102387-71102409 TCTGAGGAGCGGGGGCAGGGTGG + Intergenic
1043048992 8:75361500-75361522 CCTGCCGAGAGGGGAGTAGGTGG + Intergenic
1043532999 8:81171485-81171507 CCAGCTGAGTGGGGGTTGGGGGG + Intergenic
1044728878 8:95214472-95214494 GCTGCTGAGCTGAGGCTGGGTGG - Intergenic
1045510874 8:102810900-102810922 CTCGGCGAGCGGGGGCAGGGCGG + Intergenic
1046978393 8:120309826-120309848 TCTGCAGCGCTGGGGCTGGGTGG + Intronic
1047254894 8:123207383-123207405 CCTGCCGAGCGGCCGCTGAAGGG - Exonic
1047468692 8:125145631-125145653 CCTGCCAAGCGAAGTCTGGGAGG - Intronic
1047732454 8:127737994-127738016 CCGGGGGAGCGGGGGCTCGGCGG + Intronic
1049393296 8:142382962-142382984 CCAGCCGAGCAGGGTCTGGGGGG + Intronic
1049762053 8:144336198-144336220 CCTGCGGAGCCGGGGCTTGGGGG + Exonic
1053173972 9:35909369-35909391 ACTGCTGAGCGGGGGTTGGAGGG + Intergenic
1053312370 9:37027726-37027748 CCCTCCGGGCGGGGGCGGGGCGG + Intronic
1057146831 9:92764396-92764418 CTTGCCAAGCGGGGGCCGGCAGG - Intronic
1058418999 9:104817199-104817221 GCTGCTGGGCTGGGGCTGGGTGG - Intronic
1061675324 9:132212319-132212341 GCTGACGGGCGGGTGCTGGGAGG - Intronic
1061804214 9:133129091-133129113 TCTGCCGGGGAGGGGCTGGGTGG - Intronic
1062091600 9:134681299-134681321 CCTGCAGAGCCGGGGAAGGGCGG - Intronic
1062381665 9:136289910-136289932 CATGCCGGGCGGGGCCTTGGGGG - Intronic
1062465076 9:136677358-136677380 CCGGCTGAGCTGGGGCTGTGTGG - Intronic
1062548939 9:137077278-137077300 CCGGACGCGGGGGGGCTGGGGGG + Intergenic
1062591033 9:137274776-137274798 CCTGGCCAGCTGGGGCGGGGGGG + Intergenic
1062607829 9:137355924-137355946 CCTGTCCAGAGGGGCCTGGGAGG + Intronic
1062696396 9:137878222-137878244 CCTGCCGGGCGGGGCCGGGCGGG + Intronic
1187205576 X:17177978-17178000 CCTGCCAAGTGGGGGTTGCGAGG + Intergenic
1189534399 X:41922746-41922768 CCTGCCAGGCGGGGGCCTGGGGG - Intronic
1189534715 X:41923876-41923898 GCTGCCGAGGCGGGGCTGGTTGG + Intergenic
1191861147 X:65667538-65667560 CCTGGCCAGGCGGGGCTGGGCGG + Intronic
1192185128 X:68941592-68941614 CCTGCAGGGCGGGGGTGGGGTGG - Intergenic
1192212477 X:69136791-69136813 CCGGCCTAGCTGGGTCTGGGTGG - Intergenic
1197854754 X:130902923-130902945 CCTGCAGAGGTGGAGCTGGGTGG + Intronic
1199881173 X:151974947-151974969 CCCGCGGCGCGGGGCCTGGGCGG + Intergenic
1199942226 X:152637936-152637958 GCTGCCGGGCGGGCCCTGGGGGG + Intergenic
1201283989 Y:12363614-12363636 TCTGCCCTGTGGGGGCTGGGAGG + Intergenic