ID: 1177160712

View in Genome Browser
Species Human (GRCh38)
Location 21:17545139-17545161
Sequence TAAGATATGGTATGGTTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177160712_1177160718 -2 Left 1177160712 21:17545139-17545161 CCCGTGAACCATACCATATCTTA No data
Right 1177160718 21:17545160-17545182 TAGTGCTTAGGGCCTCCTCCAGG No data
1177160712_1177160722 18 Left 1177160712 21:17545139-17545161 CCCGTGAACCATACCATATCTTA No data
Right 1177160722 21:17545180-17545202 AGGTCATCATCCAGCTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177160712 Original CRISPR TAAGATATGGTATGGTTCAC GGG (reversed) Intronic