ID: 1177160713

View in Genome Browser
Species Human (GRCh38)
Location 21:17545140-17545162
Sequence CTAAGATATGGTATGGTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177160713_1177160718 -3 Left 1177160713 21:17545140-17545162 CCGTGAACCATACCATATCTTAG No data
Right 1177160718 21:17545160-17545182 TAGTGCTTAGGGCCTCCTCCAGG No data
1177160713_1177160722 17 Left 1177160713 21:17545140-17545162 CCGTGAACCATACCATATCTTAG No data
Right 1177160722 21:17545180-17545202 AGGTCATCATCCAGCTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177160713 Original CRISPR CTAAGATATGGTATGGTTCA CGG (reversed) Intronic