ID: 1177160717 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:17545152-17545174 |
| Sequence | AGGCCCTAAGCACTAAGATA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1177160717_1177160725 | 28 | Left | 1177160717 | 21:17545152-17545174 | CCATATCTTAGTGCTTAGGGCCT | No data | ||
| Right | 1177160725 | 21:17545203-17545225 | TTGTCAGAGTCAGGTGACATAGG | 0: 1 1: 0 2: 1 3: 14 4: 162 |
||||
| 1177160717_1177160724 | 19 | Left | 1177160717 | 21:17545152-17545174 | CCATATCTTAGTGCTTAGGGCCT | No data | ||
| Right | 1177160724 | 21:17545194-17545216 | CTCTGAAGGTTGTCAGAGTCAGG | 0: 1 1: 0 2: 2 3: 13 4: 127 |
||||
| 1177160717_1177160722 | 5 | Left | 1177160717 | 21:17545152-17545174 | CCATATCTTAGTGCTTAGGGCCT | No data | ||
| Right | 1177160722 | 21:17545180-17545202 | AGGTCATCATCCAGCTCTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1177160717 | Original CRISPR | AGGCCCTAAGCACTAAGATA TGG (reversed) | Intronic | ||