ID: 1177160718

View in Genome Browser
Species Human (GRCh38)
Location 21:17545160-17545182
Sequence TAGTGCTTAGGGCCTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177160712_1177160718 -2 Left 1177160712 21:17545139-17545161 CCCGTGAACCATACCATATCTTA No data
Right 1177160718 21:17545160-17545182 TAGTGCTTAGGGCCTCCTCCAGG No data
1177160711_1177160718 -1 Left 1177160711 21:17545138-17545160 CCCCGTGAACCATACCATATCTT No data
Right 1177160718 21:17545160-17545182 TAGTGCTTAGGGCCTCCTCCAGG No data
1177160713_1177160718 -3 Left 1177160713 21:17545140-17545162 CCGTGAACCATACCATATCTTAG No data
Right 1177160718 21:17545160-17545182 TAGTGCTTAGGGCCTCCTCCAGG No data
1177160714_1177160718 -10 Left 1177160714 21:17545147-17545169 CCATACCATATCTTAGTGCTTAG No data
Right 1177160718 21:17545160-17545182 TAGTGCTTAGGGCCTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177160718 Original CRISPR TAGTGCTTAGGGCCTCCTCC AGG Intronic