ID: 1177160719

View in Genome Browser
Species Human (GRCh38)
Location 21:17545172-17545194
Sequence GCTGGATGATGACCTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177160719_1177160725 8 Left 1177160719 21:17545172-17545194 CCTCCTCCAGGTCATCATCCAGC No data
Right 1177160725 21:17545203-17545225 TTGTCAGAGTCAGGTGACATAGG No data
1177160719_1177160724 -1 Left 1177160719 21:17545172-17545194 CCTCCTCCAGGTCATCATCCAGC No data
Right 1177160724 21:17545194-17545216 CTCTGAAGGTTGTCAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177160719 Original CRISPR GCTGGATGATGACCTGGAGG AGG (reversed) Intronic