ID: 1177160720

View in Genome Browser
Species Human (GRCh38)
Location 21:17545175-17545197
Sequence AGAGCTGGATGATGACCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177160720_1177160725 5 Left 1177160720 21:17545175-17545197 CCTCCAGGTCATCATCCAGCTCT No data
Right 1177160725 21:17545203-17545225 TTGTCAGAGTCAGGTGACATAGG No data
1177160720_1177160724 -4 Left 1177160720 21:17545175-17545197 CCTCCAGGTCATCATCCAGCTCT No data
Right 1177160724 21:17545194-17545216 CTCTGAAGGTTGTCAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177160720 Original CRISPR AGAGCTGGATGATGACCTGG AGG (reversed) Intronic