ID: 1177160724

View in Genome Browser
Species Human (GRCh38)
Location 21:17545194-17545216
Sequence CTCTGAAGGTTGTCAGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177160719_1177160724 -1 Left 1177160719 21:17545172-17545194 CCTCCTCCAGGTCATCATCCAGC No data
Right 1177160724 21:17545194-17545216 CTCTGAAGGTTGTCAGAGTCAGG No data
1177160720_1177160724 -4 Left 1177160720 21:17545175-17545197 CCTCCAGGTCATCATCCAGCTCT No data
Right 1177160724 21:17545194-17545216 CTCTGAAGGTTGTCAGAGTCAGG No data
1177160714_1177160724 24 Left 1177160714 21:17545147-17545169 CCATACCATATCTTAGTGCTTAG No data
Right 1177160724 21:17545194-17545216 CTCTGAAGGTTGTCAGAGTCAGG No data
1177160721_1177160724 -7 Left 1177160721 21:17545178-17545200 CCAGGTCATCATCCAGCTCTGAA No data
Right 1177160724 21:17545194-17545216 CTCTGAAGGTTGTCAGAGTCAGG No data
1177160717_1177160724 19 Left 1177160717 21:17545152-17545174 CCATATCTTAGTGCTTAGGGCCT No data
Right 1177160724 21:17545194-17545216 CTCTGAAGGTTGTCAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177160724 Original CRISPR CTCTGAAGGTTGTCAGAGTC AGG Intronic