ID: 1177160725

View in Genome Browser
Species Human (GRCh38)
Location 21:17545203-17545225
Sequence TTGTCAGAGTCAGGTGACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177160717_1177160725 28 Left 1177160717 21:17545152-17545174 CCATATCTTAGTGCTTAGGGCCT No data
Right 1177160725 21:17545203-17545225 TTGTCAGAGTCAGGTGACATAGG No data
1177160723_1177160725 -10 Left 1177160723 21:17545190-17545212 CCAGCTCTGAAGGTTGTCAGAGT No data
Right 1177160725 21:17545203-17545225 TTGTCAGAGTCAGGTGACATAGG No data
1177160720_1177160725 5 Left 1177160720 21:17545175-17545197 CCTCCAGGTCATCATCCAGCTCT No data
Right 1177160725 21:17545203-17545225 TTGTCAGAGTCAGGTGACATAGG No data
1177160719_1177160725 8 Left 1177160719 21:17545172-17545194 CCTCCTCCAGGTCATCATCCAGC No data
Right 1177160725 21:17545203-17545225 TTGTCAGAGTCAGGTGACATAGG No data
1177160721_1177160725 2 Left 1177160721 21:17545178-17545200 CCAGGTCATCATCCAGCTCTGAA No data
Right 1177160725 21:17545203-17545225 TTGTCAGAGTCAGGTGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177160725 Original CRISPR TTGTCAGAGTCAGGTGACAT AGG Intronic