ID: 1177160849

View in Genome Browser
Species Human (GRCh38)
Location 21:17546500-17546522
Sequence CCACGTGGCCAGAGCAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177160838_1177160849 28 Left 1177160838 21:17546449-17546471 CCTCAGGAAACTTACAATCATGG 0: 5548
1: 8228
2: 6830
3: 4292
4: 3006
Right 1177160849 21:17546500-17546522 CCACGTGGCCAGAGCAGAGAAGG 0: 1
1: 0
2: 4
3: 34
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177160849 Original CRISPR CCACGTGGCCAGAGCAGAGA AGG Intronic
900534812 1:3171611-3171633 GCTCGTGGCCAGAGCAGATTTGG - Intronic
900940301 1:5794228-5794250 CCAAGTGGGCAGAGCAGAAGGGG + Intergenic
900970520 1:5990126-5990148 CCTAGAGGCCAGAGCAGAGGTGG - Intronic
901041633 1:6367753-6367775 CCACGTTGCCAGTGAAGGGAAGG - Intronic
901154268 1:7124980-7125002 CTAGGAGGACAGAGCAGAGACGG - Intronic
901652087 1:10748831-10748853 CCACGTGGCCAGAGCAAGCATGG + Intronic
901652592 1:10751777-10751799 CCAGGGGGCCAGGGCAGAGGAGG + Intronic
902070088 1:13727078-13727100 CCATGTGTCCAGAGCAGAGAAGG - Intronic
902569778 1:17339764-17339786 CCACGTGGCCAGGTCTGAGATGG + Exonic
902862863 1:19258404-19258426 CAACATGACCAGGGCAGAGAGGG + Intronic
903195659 1:21685882-21685904 CCAGGTGGCCAGATCACAGGGGG + Intronic
903650228 1:24917458-24917480 GCACGTGGCCGTAGCACAGAGGG - Intronic
903934272 1:26884124-26884146 CTTCCTGGCCATAGCAGAGAGGG - Intronic
904920627 1:34005200-34005222 CCTCTTGGCCAAGGCAGAGAGGG - Intronic
905359584 1:37410289-37410311 CCACATCGCCAGAGAAGAAAGGG - Intergenic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
907460238 1:54601459-54601481 CCACCATGCCAGGGCAGAGAGGG - Intronic
910002174 1:82354247-82354269 CCATGTGGCTATAGCAGAGTGGG - Intergenic
910909034 1:92214522-92214544 CCACGTGTCAAGAGCAGAACAGG + Intergenic
911054506 1:93698567-93698589 CTCCGTGGCCAGAGGAGAGAAGG + Intronic
911500251 1:98677406-98677428 CTACGTGGTCAGAGCAGAGGAGG + Intronic
915339822 1:155170734-155170756 CCAGGTGGAGAGGGCAGAGAAGG + Intronic
915786206 1:158615184-158615206 GCGTGTGGCCAGAGCAGGGAGGG - Intronic
915803228 1:158816771-158816793 CCAAATATCCAGAGCAGAGATGG - Intergenic
917634759 1:176924402-176924424 CCAGATGGCCAGCACAGAGAAGG - Intronic
918143209 1:181734917-181734939 TCATGAGGCCAGAGCAGGGATGG - Intronic
920309770 1:205042161-205042183 CCACGTGACCGGAGCAGGGCAGG + Intergenic
920916642 1:210262923-210262945 CCGGGAGGGCAGAGCAGAGAGGG - Intergenic
1063464482 10:6233895-6233917 CCACCTGGGAAGAGCAGGGACGG - Exonic
1063702226 10:8395449-8395471 CCATGTGGCCAGAGCTCAGGTGG + Intergenic
1065172904 10:23049639-23049661 CCACTTGGATAGAGCAGGGAAGG + Intergenic
1067176849 10:43956134-43956156 CCACGGGCCCAGGGCAGTGATGG + Intergenic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1068003402 10:51363799-51363821 TGACGTGGTCAGGGCAGAGAAGG - Intronic
1068461676 10:57337185-57337207 GAGCGTGGCCAGAGCAGAGGTGG + Intergenic
1070748544 10:78950052-78950074 TCCTGTGACCAGAGCAGAGAAGG + Intergenic
1071671625 10:87614349-87614371 CTGCCTGGCCAGAGCAGAGGTGG - Intergenic
1073585822 10:104709001-104709023 CCAGGTGGCCAAGGCAGAGGAGG - Intronic
1074777578 10:116777513-116777535 CCTCGTGCCCAGACCAGACAGGG + Intergenic
1076302928 10:129441701-129441723 GCACGGGGACAGAGCAGAGCAGG - Intergenic
1076431161 10:130403358-130403380 CCACATGGCCAGCCCAGAGCAGG + Intergenic
1076528135 10:131125695-131125717 CCACGTGAGCAGAGCAGAGCTGG - Intronic
1076624030 10:131810771-131810793 CCACGTGGCCAGGGGAGACGGGG - Intergenic
1076715628 10:132362471-132362493 CCTGGTGGACAGAGCAGAGTCGG + Intronic
1077009041 11:372000-372022 CCACATGGCCAGAGCAGGGCAGG - Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078008919 11:7555190-7555212 CCACGTGGTCAGGACACAGAAGG + Intronic
1078267446 11:9765754-9765776 CCCTGTGGCCAGCCCAGAGAGGG - Intergenic
1078480222 11:11668973-11668995 CCCCGTGCTCTGAGCAGAGAGGG - Intergenic
1078619471 11:12893813-12893835 CCAAGTGGCCAGAACAGGGCTGG + Intronic
1079099200 11:17530294-17530316 CCTCAGGGCCTGAGCAGAGATGG - Intronic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1083376878 11:62230823-62230845 GCAGGAGGCCAGAGTAGAGAAGG - Intergenic
1083955933 11:65982730-65982752 CCACGTGGACAGTGGAGAGCAGG + Intergenic
1084539165 11:69775669-69775691 CAAGGCGGCCGGAGCAGAGAGGG - Intergenic
1084601113 11:70146406-70146428 CAAGCTGGCCAGTGCAGAGAGGG + Intronic
1085409054 11:76280997-76281019 CCACGAGTCCAGAGCTCAGAGGG + Intergenic
1085652895 11:78284500-78284522 CCACGTGGCCAGAGCAGAATAGG - Intronic
1089517809 11:119044890-119044912 CCTAGTGGCCAGAGGAGGGAGGG - Exonic
1092033022 12:5305625-5305647 CCTCCTGGCCAGGGCACAGATGG - Intergenic
1092105519 12:5919326-5919348 CAAGGTGCCCAAAGCAGAGAGGG + Intronic
1092105534 12:5919416-5919438 CAAGGTGCCCAAAGCAGAGAGGG + Intronic
1092105541 12:5919461-5919483 CAAGGTGCCCAAAGCAGAGAGGG + Intronic
1092105548 12:5919506-5919528 CAAGGTGCCCAAAGCAGAGAGGG + Intronic
1092105555 12:5919551-5919573 CAAGGTGCCCAAAGCAGAGAGGG + Intronic
1092981705 12:13801466-13801488 CCACAGGCCCAGAACAGAGAAGG + Intronic
1093832556 12:23781282-23781304 TTAGTTGGCCAGAGCAGAGATGG - Intronic
1094449000 12:30564203-30564225 CCAGGTTGCAAGTGCAGAGAAGG - Intergenic
1096231618 12:49900061-49900083 CCAGGTGGCCAGGCCACAGAGGG + Intronic
1096239222 12:49950677-49950699 CCACGTGCCCAGATCCGGGATGG + Intergenic
1096491311 12:52014680-52014702 CCACCAGGCCTGCGCAGAGACGG - Exonic
1096595412 12:52692004-52692026 CCACAGGGCCTGAGGAGAGAAGG + Intronic
1097803220 12:63938112-63938134 TCATGTGGCCAGAGAAGAAAGGG + Intronic
1099724656 12:86410947-86410969 TTACATGGCCAGAGCAGAGGAGG - Intronic
1101528240 12:105551084-105551106 CCAGGTGGCCAGAGCAGAGGAGG - Intergenic
1101601697 12:106215390-106215412 GCAGGTGGCCAGGGCAGAGATGG + Intergenic
1102225321 12:111224381-111224403 GCTCGGGGCCAGAGCAGGGAGGG - Intronic
1102344572 12:112151342-112151364 CCACATCTCCAGGGCAGAGATGG - Intronic
1103610947 12:122124019-122124041 CAACCTGACCAGAGCAGTGAGGG - Intronic
1106132665 13:26952758-26952780 GCACGAGGGCTGAGCAGAGAGGG - Intergenic
1108225561 13:48285517-48285539 CCATGTGGCCTGAGCACAGCAGG - Intergenic
1110646113 13:77886504-77886526 CCACGTAGGCGGAGGAGAGAAGG + Intergenic
1112688553 13:101862043-101862065 CCAAGGGGCTAGAGCAGATAAGG + Intronic
1113189020 13:107722459-107722481 CAAGGTGGCCAGAGCAGTGCAGG - Intronic
1113574848 13:111388112-111388134 GCAGGTGCCCAGAGCAGAGGTGG - Intergenic
1114675286 14:24436234-24436256 CCCCATGGCCAGAGCAGAGCTGG - Intronic
1114864455 14:26571593-26571615 CCACGTGGCTAGAACACAGAGGG + Intronic
1115305295 14:31927697-31927719 CCATGTGACTAGGGCAGAGATGG - Intergenic
1117344319 14:54817891-54817913 TCAGGAGCCCAGAGCAGAGAAGG + Intergenic
1117784674 14:59270354-59270376 TCACGTGGCCAGAGAAGCAATGG + Intronic
1118325183 14:64775505-64775527 CCCCGTTGCTAGAGCAGAGCAGG + Intronic
1118917316 14:70118466-70118488 CAACATGGCCAGAGCTGAAAAGG - Intronic
1118973446 14:70656707-70656729 GTACTTGGCCAGAGCTGAGAAGG + Intronic
1119821193 14:77617118-77617140 CCACGAGGCAAGGGCAAAGAGGG - Intergenic
1119879795 14:78091253-78091275 CCAGATGGCCAGATCAAAGAGGG - Intergenic
1120861548 14:89259385-89259407 CCTAGTGACCAGAGCAAAGAGGG - Intronic
1121571341 14:94948875-94948897 ACACGTGGCCAGTGCAGTGGAGG + Intergenic
1122163378 14:99802627-99802649 CCAGGGGGCCTGTGCAGAGATGG + Intronic
1122204551 14:100142058-100142080 CCACGTGGGAAGAGCATGGAGGG + Intronic
1122588067 14:102825111-102825133 CAGCGTGGGCAGAGCAGAAAGGG - Intronic
1122891829 14:104735599-104735621 CCACGTGGCCACAGCAGCCCAGG - Intronic
1122940820 14:104980605-104980627 CCAGGTGACCAGAGCAGGGTGGG - Intergenic
1124666558 15:31597991-31598013 CCCTGTGGCCAGGGCTGAGATGG + Intronic
1126468230 15:48980044-48980066 ACCCCGGGCCAGAGCAGAGATGG - Intergenic
1126899764 15:53302988-53303010 CCATGAGGCCAGAACAGGGATGG + Intergenic
1128648508 15:69394154-69394176 CCTCCTGGTCAGAGCAGTGAGGG + Intronic
1128786785 15:70403487-70403509 CCAGGTGGACAGGGCAGAGGAGG + Intergenic
1131612936 15:93984022-93984044 CCCTGGGGGCAGAGCAGAGACGG - Intergenic
1132594036 16:740242-740264 CCGCGGGGCCAGAGCTGAGCAGG - Intronic
1132708713 16:1257212-1257234 GCAGGTGCCCTGAGCAGAGACGG + Intronic
1132806852 16:1778905-1778927 CCACCTGCCCAGAGCTGAGATGG + Intronic
1132809931 16:1792644-1792666 CCACGTGGCCTGCGCACAGCTGG - Intronic
1133241266 16:4416002-4416024 CGCCGGGGCCAGAGGAGAGAGGG + Intronic
1133347573 16:5080891-5080913 CCACGTGGCAGGGACAGAGATGG + Intronic
1133381042 16:5330734-5330756 CCCTGTGGCCACAGCAGACAAGG + Intergenic
1133768898 16:8856369-8856391 CCTCGTGACCAGATCAAAGAGGG - Intronic
1134054721 16:11162565-11162587 CCCCTTGTCCAGAGCAGAGAAGG - Intronic
1136178922 16:28537835-28537857 CCTAGTGGCCAGAGCAAAGTGGG - Intronic
1137690252 16:50421390-50421412 CCACATGGCCAATGCTGAGATGG + Intergenic
1138197210 16:55060501-55060523 CCATGTGGCTGGAGCAGAGTGGG - Intergenic
1138273511 16:55713266-55713288 CCATGTGGGGAGATCAGAGAGGG + Intergenic
1139722716 16:68869879-68869901 CCACGTGGGTAGAGTAGTGAGGG + Intronic
1139957915 16:70701888-70701910 CCATCTGGCCAGGGCAGAGCAGG - Intronic
1141525925 16:84611877-84611899 CTACCTGGCCACAGCAGAAAGGG - Intronic
1141815830 16:86408701-86408723 CCAGGTATCCAGAGCAGAGAGGG - Intergenic
1142218555 16:88841706-88841728 CCACTGGGCCAGGGCAGGGAAGG + Intronic
1142265508 16:89062466-89062488 CCCAGAGCCCAGAGCAGAGACGG + Intergenic
1142812371 17:2401247-2401269 ACACGTGGCCCGGGCAGGGAGGG + Intergenic
1143138303 17:4724933-4724955 CCCTGTGTTCAGAGCAGAGAAGG - Intergenic
1143550978 17:7630324-7630346 CTACAGGGCCAGAGGAGAGAAGG - Intronic
1143651433 17:8266238-8266260 CATCGTGGCCTGAGCAGAGGAGG - Exonic
1144520388 17:15948768-15948790 CAATGTGGCAAGAGCAGAGAGGG - Intronic
1144669903 17:17127060-17127082 TAAGGTGGCCAGAGCAAAGAGGG - Intronic
1146063261 17:29617944-29617966 CCAAGAGGCCAGAGCGGAGCGGG - Intronic
1146485776 17:33241409-33241431 CCATGTGGTGAGAGCAGAGAAGG - Intronic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1148552713 17:48560098-48560120 AAAGGTGGGCAGAGCAGAGAAGG + Intronic
1149434550 17:56622035-56622057 CCAGGTGGACAAGGCAGAGATGG - Intergenic
1149734057 17:58975652-58975674 CCAGGAGGTTAGAGCAGAGATGG + Intronic
1150136212 17:62696746-62696768 CCAGGTGGCCAGAGCGGGGCGGG - Intergenic
1150199093 17:63334931-63334953 TCACATGGCCAGAGCAGAGCAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150644929 17:66972012-66972034 CTACGTGGCAGCAGCAGAGATGG + Intronic
1150865007 17:68840313-68840335 CCACGTGGCAAGGGCACAGCTGG + Intergenic
1151414531 17:73952778-73952800 CCACGCGGACAGAGCAAGGAGGG - Intergenic
1151493064 17:74443987-74444009 CCATGTGGCCAGAGCTGGGTTGG + Intronic
1152344606 17:79743327-79743349 CCACCTGGCCAGAGGAGACCAGG + Intergenic
1154284987 18:13046183-13046205 TCACATGGCCAAAGCAGGGATGG + Intronic
1154338902 18:13487387-13487409 CCATGTGGCCAGACCAGGAAGGG + Intronic
1156477496 18:37415229-37415251 CCATGTGGCCACCACAGAGAGGG - Intronic
1157325937 18:46668931-46668953 CCACATGGCCAGAGCAGCAGGGG + Intronic
1158580458 18:58676461-58676483 ACATGTGACCAGAGTAGAGAGGG - Intronic
1160963743 19:1736522-1736544 CCATGTGGACAGAGTCGAGAGGG + Intergenic
1160987492 19:1845903-1845925 CCACCTGGCCAGGGCAGGGCTGG - Intronic
1161862614 19:6809517-6809539 CCACCTGGCTGGAGCAGAGGTGG + Intronic
1163183771 19:15622205-15622227 CCACTTGGCCTGGCCAGAGAAGG - Exonic
1163530110 19:17843857-17843879 CTCCGTGGCCAGAGCAAAGAGGG + Exonic
1163646905 19:18494772-18494794 CCACCTGGTCAGAGCCCAGAAGG - Intronic
1164685056 19:30161124-30161146 CCCAGTGGCCAGTGCAGAGCTGG + Intergenic
1164809746 19:31146874-31146896 CCATGTGGCAAGAGCTAAGAGGG - Intergenic
1165376704 19:35448194-35448216 CCACGTGACCAGAGAAAGGAAGG - Intronic
1165846573 19:38821604-38821626 CCACCTGCCCTGAGCAGTGAGGG + Intronic
1165899391 19:39161758-39161780 CCACGTGGCTGGAGCAGGGTGGG - Intronic
1166647373 19:44542359-44542381 CCAGGTGGCCAGATCTGTGACGG - Intergenic
1166850784 19:45759685-45759707 CCACGTGCCCAGCACAGAGCCGG - Intronic
1166876244 19:45899409-45899431 CCATAGGACCAGAGCAGAGATGG - Intronic
1167104766 19:47423771-47423793 ACACATGGCCAAAGGAGAGAGGG - Intergenic
1167284189 19:48589521-48589543 GAGCGTGGACAGAGCAGAGAGGG + Intronic
1168346631 19:55653034-55653056 CCGCGGGGCCAGGGCGGAGACGG - Exonic
1168617554 19:57850690-57850712 CCAGGTGGCCAGAGCATTGGAGG + Intronic
925425277 2:3744224-3744246 CCATGAGGTGAGAGCAGAGAGGG + Intronic
925802042 2:7611044-7611066 CCAGGTGAGCAGAGCAGACAGGG - Intergenic
926801895 2:16666081-16666103 CCAAGTGGCCAAGGCTGAGAAGG - Intronic
927134952 2:20090274-20090296 CCCCATGGCCAGAGCAGTGATGG + Intergenic
928214744 2:29351941-29351963 CACTGTGGCCAGAGCTGAGAAGG - Intronic
928734181 2:34266688-34266710 CCAAGTGGCCAGAGCAGCATGGG - Intergenic
928995227 2:37282335-37282357 ACAGGTGGCCAGAGGAAAGACGG + Intronic
934112222 2:88754649-88754671 TCACGTGGCCAGTGCAGTGGAGG + Intergenic
934696447 2:96404019-96404041 CCACATTGCGAGAGAAGAGAAGG - Intergenic
936084325 2:109456167-109456189 ACAAGTGGCCAGGGCAGAGGTGG - Intronic
937264550 2:120607731-120607753 CCCCGTGGGCAGAGCTCAGAGGG + Intergenic
937869259 2:126776265-126776287 CCACCTAGCCAGTGCAGAGCTGG + Intergenic
938661526 2:133491763-133491785 CCACATGGGCAGAGCTGAGATGG + Intronic
939755717 2:146106863-146106885 CAACCTGGCCAGTGCTGAGATGG - Intergenic
942091105 2:172492137-172492159 CCACGTGGACAGAGCAGCTGAGG + Intronic
942540444 2:177009775-177009797 CAACATGGCCAGAGCTCAGAGGG - Intergenic
944901725 2:204222917-204222939 CCACGTTGCCAGTGAAGAGAGGG - Intergenic
946372970 2:219291622-219291644 CCACCTGCCCGGGGCAGAGAGGG + Intronic
946496557 2:220201512-220201534 ACACCAGGCCAGAGCAGAGATGG - Intergenic
946678373 2:222186897-222186919 CTGCATGGCCAGAGAAGAGATGG - Intergenic
947590053 2:231380292-231380314 CCACATGGCAAGAGTAGGGAGGG - Intergenic
948129827 2:235592224-235592246 CCAGGTGGCCAGGGCAGTGGAGG - Intronic
948692547 2:239715748-239715770 CCAGGAGGCCACAGCAGAGCAGG + Intergenic
949041073 2:241850211-241850233 CCAGGTGGCCACAGCTGGGAGGG + Exonic
1170914841 20:20612809-20612831 CCCTGTCGCCAGGGCAGAGAAGG + Intronic
1172595941 20:36151271-36151293 CCTCCTAGACAGAGCAGAGAGGG + Intronic
1172904731 20:38360644-38360666 GCACGGGGCCAGACCAGAGCTGG + Intronic
1173384093 20:42572421-42572443 CCATGTGGCCACAGCAGAGAAGG - Intronic
1173726377 20:45301137-45301159 CCACGGTGCCACTGCAGAGAGGG - Exonic
1174001850 20:47380496-47380518 CCACGTAACAGGAGCAGAGAAGG + Intergenic
1174103322 20:48143990-48144012 CCATGTCTCCAGAGCAGAGCAGG + Intergenic
1174180383 20:48670612-48670634 GGACGTGGCCAGGGCAGAGCGGG - Intronic
1174615041 20:51829000-51829022 CCAGGGGGCCAGAGCAGAAGTGG - Intergenic
1175172763 20:57091808-57091830 CCAGGCAGCCAAAGCAGAGAGGG + Intergenic
1176019387 20:62954723-62954745 CCACCTGCCCAGCTCAGAGAAGG + Intronic
1177160849 21:17546500-17546522 CCACGTGGCCAGAGCAGAGAAGG + Intronic
1178948952 21:36970206-36970228 TCAAATGGCCAGAGCTGAGAAGG + Intronic
1179799828 21:43806105-43806127 ACACATGGCCAGAACAGACACGG - Intergenic
1180142176 21:45899352-45899374 CCACCTGACCAGGACAGAGATGG - Intronic
1180740630 22:18050939-18050961 CCACGTAAGCAGAGAAGAGATGG - Intergenic
1180965802 22:19787412-19787434 CCAGGTGGCCGGAGCAGGGGTGG - Exonic
1183358625 22:37372158-37372180 CCACGTGGCCTGGGAAGAGTGGG - Exonic
1184992877 22:48182503-48182525 CCAGGTGGGCAGTGCAGAAAGGG - Intergenic
1185148522 22:49151806-49151828 CCATGTGGCCTGTCCAGAGAGGG - Intergenic
1185181745 22:49367531-49367553 CCACCTGCCCACAGCACAGAGGG + Intergenic
950499546 3:13354945-13354967 CTATGTGGCCAGAGAAGGGAGGG - Intronic
951272955 3:20649977-20649999 TCACGTGGCCAGAGCAGTAGAGG - Intergenic
953393771 3:42550091-42550113 CCACGGGGCCAGAGCCCAAAAGG - Intronic
953884251 3:46706583-46706605 CCACGAGGCAAAAGCAGAGTGGG + Intronic
955357887 3:58246566-58246588 CCAGGTGGCCAAAGCAGGGAGGG + Intronic
956554287 3:70500690-70500712 CCACATGTCCTTAGCAGAGAGGG - Intergenic
961829420 3:129615853-129615875 CCGTGTGGGCAGAGCAGAGGAGG + Intergenic
962405295 3:135095074-135095096 TGAAGTGTCCAGAGCAGAGAAGG - Intronic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
965623086 3:170659997-170660019 ACACATGGCTAGAGCATAGAAGG - Intronic
966684915 3:182683012-182683034 CCCCTTGGCCAGAGCCGAGGCGG - Intergenic
968729761 4:2264147-2264169 CCCAGTGGCCAAAGCAGGGATGG - Intergenic
968920655 4:3520832-3520854 CCACGTGGGCAGATCCTAGAGGG - Intronic
969350389 4:6594886-6594908 CCAGGTGGAGTGAGCAGAGAGGG - Intronic
969819200 4:9707782-9707804 CCACGTGGCAGGGACAGAGACGG - Intergenic
972651186 4:41019312-41019334 CCACGTGATGAGAGAAGAGAAGG + Intronic
973855120 4:55003560-55003582 CCTCGTGGTCAAAGCAGAGAAGG - Intergenic
982435628 4:155381489-155381511 CCATGTTGCCAGAGCATTGAGGG - Intergenic
983735337 4:171051965-171051987 CCACAGGACCAGAGCAAAGATGG - Intergenic
984102059 4:175498935-175498957 CCACATTGCCAGTGAAGAGAAGG - Intergenic
985104370 4:186486450-186486472 CCAGGGGTCCAGAGCAGACACGG + Intronic
985580591 5:693549-693571 CCGCGGGGCCTGAGCAGAGTCGG - Intergenic
985609924 5:881743-881765 CCACCTGGCCTGAGAAGAGCCGG + Intronic
985610342 5:884511-884533 CCCAGTGGCCACAGCAGAGGGGG - Intronic
988716842 5:33836820-33836842 CAAGGTGGCCAGAGCCTAGAGGG + Intronic
991188211 5:63836050-63836072 CCACGTGGCCAGCGCTGGTATGG - Intergenic
992126696 5:73649800-73649822 CCAAGTAGCCAGAGAAAAGACGG + Intronic
992233924 5:74688868-74688890 TAAAGTGGACAGAGCAGAGATGG - Intronic
992244221 5:74801875-74801897 GCATGTGGACTGAGCAGAGAAGG - Intronic
997530684 5:134579562-134579584 CCACGTGGGCAGGGCAGGGATGG - Exonic
997532586 5:134591370-134591392 CAACTTGGGCAGAGGAGAGAAGG + Intergenic
999339138 5:150753597-150753619 GCTCGTGGCCCGAGTAGAGAGGG + Exonic
999365898 5:151023201-151023223 CCACGTGCCCAGAGAAGGGAAGG + Intronic
1000744734 5:165018745-165018767 TCCGGTGGTCAGAGCAGAGATGG + Intergenic
1001230428 5:169982575-169982597 CCACTTGGTAAGAGCTGAGAGGG - Intronic
1001495363 5:172184431-172184453 CCCGGTGCCCAGAGAAGAGAAGG - Intronic
1001779949 5:174359634-174359656 CCAGGTGCCCAGAGCAGAGTAGG - Intergenic
1001969926 5:175947313-175947335 CAAGGTGTCCATAGCAGAGATGG - Intronic
1002105135 5:176876327-176876349 CCTCGTGGGCAGCGCAGAGCAGG - Intronic
1002247512 5:177896455-177896477 CAAGGTGTCCATAGCAGAGATGG + Intergenic
1003288242 6:4753839-4753861 CCTAGTGGCCAGAGCAAAGAGGG - Intronic
1004412075 6:15390402-15390424 CAACGTGGACAGAGCTAAGAAGG - Intronic
1004541058 6:16550267-16550289 CCACATTGCCAGAGCTGAGAGGG - Intronic
1006152515 6:31996974-31996996 TCACGAGGGCAAAGCAGAGATGG + Exonic
1006158821 6:32029711-32029733 TCACGAGGGCAAAGCAGAGATGG + Exonic
1007230607 6:40345333-40345355 CCACGTTTCCAGAGGAGAGTTGG - Intergenic
1007402807 6:41613882-41613904 CTACGAGGCCAGAACAAAGAAGG + Intergenic
1009370057 6:62888395-62888417 CCACGTGGCTATAGCTGGGATGG - Intergenic
1012431797 6:99171856-99171878 CTCCGTGGCCAGTACAGAGAGGG + Intergenic
1017554413 6:155547574-155547596 CCACTTGACCACAGCAGAGATGG + Intergenic
1017581798 6:155873005-155873027 CCCTGTGGTCAGAACAGAGAGGG + Intergenic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1018982699 6:168612821-168612843 GCACCTGTCCAGAGCAGAGCAGG + Intronic
1019438151 7:1032298-1032320 GCTGTTGGCCAGAGCAGAGAAGG + Intronic
1019695912 7:2446100-2446122 CCACCTGGGCTGTGCAGAGACGG - Intergenic
1021143550 7:17057015-17057037 CCATGGGGTCAGAGCAAAGAAGG + Intergenic
1023864496 7:44232380-44232402 GCTGATGGCCAGAGCAGAGAGGG + Intronic
1024291162 7:47805505-47805527 CCAAGGTGCCAGAACAGAGACGG + Intronic
1025715604 7:63952937-63952959 CACCGAGGCCAGAGCAGAAATGG - Intergenic
1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG + Intronic
1030006229 7:105123347-105123369 CCACGCAGCCAGAGAAGAGTGGG - Intronic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1032688607 7:134259987-134260009 CCATCTGGCCAGAGCAAAGTGGG + Intronic
1032700008 7:134371003-134371025 CCAGGTGGGCAGAGGAGATACGG + Intergenic
1033165213 7:139034211-139034233 CCACTTGGCCAGAAGAGGGATGG - Intronic
1034806253 7:154091719-154091741 CCACGTGGCCTCAGGAGATAGGG + Intronic
1034958764 7:155351412-155351434 CCATGTGGCCTCAGCAGAAATGG - Intergenic
1035907694 8:3531578-3531600 CCACGGGGCCAGACCACAGATGG - Intronic
1036078062 8:5523031-5523053 CCACATAGCCAGGGTAGAGAAGG + Intergenic
1036761917 8:11515194-11515216 GGAGGTGGCCACAGCAGAGAAGG + Intronic
1036778524 8:11629951-11629973 CTCCATGGCCAGAGGAGAGAGGG + Intergenic
1036847278 8:12178658-12178680 CCACGTGGCAGGGACAGAGACGG + Intergenic
1036868643 8:12420979-12421001 CCACGTGGCAGGGACAGAGACGG + Intergenic
1036902000 8:12676991-12677013 CCATGTGGGCAGTGCAGAAAAGG - Intergenic
1036922325 8:12869329-12869351 TCAAGTGGCCGTAGCAGAGAGGG + Intergenic
1037243746 8:16807069-16807091 CCAGGTGCCCAGAGTAGAAATGG + Intergenic
1037415960 8:18649842-18649864 TCACATGGCCAGAGCAGGGTGGG - Intronic
1047446758 8:124927054-124927076 GCACGTGGCCAGAACCCAGAGGG + Intergenic
1048042765 8:130747145-130747167 CTAGGTAGCCAAAGCAGAGAGGG - Intergenic
1048352365 8:133626492-133626514 CCACGTGGCCAGAGGGGAGTAGG + Intergenic
1048616585 8:136081534-136081556 GCACCAGGCCAGAGCAGAGCTGG - Intergenic
1048881005 8:138872492-138872514 CCAGCTGGCCACAGCCGAGAAGG - Intronic
1049041863 8:140118572-140118594 CCAGGTGGCAGGAGCAGAGAAGG + Intronic
1049278817 8:141733590-141733612 CTACGTGACCAGTGCAGACATGG - Intergenic
1049782891 8:144436854-144436876 CCAGGTGGCCAGGGCTGCGAAGG - Exonic
1050814624 9:9794468-9794490 CAATGTGGCTAGAGCAGAGAAGG + Intronic
1053477459 9:38392733-38392755 CCATGTGGACAGAGCTGGGAGGG + Exonic
1056238419 9:84619083-84619105 CCTTGTCCCCAGAGCAGAGAAGG - Intergenic
1056252679 9:84766282-84766304 TAAGGTGGCCAGAGCAGAGTGGG + Intronic
1056944873 9:90985664-90985686 TCACATGGCCAGACCAGAGCAGG - Intergenic
1057444502 9:95104193-95104215 CCACGCGGCCACCGCAGCGAAGG + Intronic
1057705343 9:97391651-97391673 CCACATGTACAGGGCAGAGATGG - Intergenic
1060055321 9:120408233-120408255 CCACAAGGCCAGAGTGGAGAGGG + Intronic
1061066271 9:128279502-128279524 CTAGGTAGCCAAAGCAGAGAGGG + Intronic
1061683928 9:132259431-132259453 CCAGACGGCCAGAGCAGAGCGGG - Intergenic
1061923936 9:133796903-133796925 CCCAGAGGCCAGACCAGAGAGGG - Intronic
1062093026 9:134688530-134688552 CCACCTGGCCCCAGCAAAGAAGG - Intronic
1062107253 9:134762458-134762480 CCATGGGGCCAGAGCACAGGAGG + Intronic
1062634198 9:137481348-137481370 CCACGTGTGCAGGGCAGGGAAGG + Intronic
1187025851 X:15434499-15434521 CCATGTGGCCAAACCAGAGGTGG - Intronic
1187158793 X:16745336-16745358 CCACATGGGCAGAGCAGGGCAGG + Intronic
1187581292 X:20610171-20610193 CCACCTGGCAGGAGTAGAGAAGG - Intergenic
1188526933 X:31097330-31097352 CCCCGTGGCCAGACCAGGCATGG + Intergenic
1189422234 X:40866443-40866465 CCATGTGGCCAAAGTAGAGATGG - Intergenic
1190284778 X:48954895-48954917 CCTCGTGGCCAGGGCCAAGAAGG - Intronic
1195869578 X:109472213-109472235 CCACGTGGCCGTAGCAGTGGTGG - Intronic
1197892166 X:131278687-131278709 CCACGGGGCCAGAGGAAAGTTGG + Exonic
1198784691 X:140274104-140274126 CCACTTGGCAGCAGCAGAGATGG + Intergenic
1199243638 X:145576905-145576927 CTATGTGGCTAGAGGAGAGAAGG + Intergenic
1199622810 X:149714606-149714628 CCTCCTGGCCAGAACACAGAGGG + Intronic
1199628504 X:149760904-149760926 CCTCCTGGCCAGAACACAGATGG + Intergenic
1199855333 X:151754839-151754861 CCACATGGTCAGAGCAGAAAAGG - Intergenic
1200043501 X:153387514-153387536 CCAGGAGGACAGAGCAGAGCAGG + Intergenic
1200091392 X:153637743-153637765 CCACCCGGCCAGAGCAAGGAAGG - Intergenic
1200845543 Y:7828827-7828849 CACCGTGGCCAGAGCAGAAGTGG - Intergenic