ID: 1177164543

View in Genome Browser
Species Human (GRCh38)
Location 21:17585368-17585390
Sequence GGTCACACAATTCGAAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177164543_1177164545 18 Left 1177164543 21:17585368-17585390 CCATGTTTTCGAATTGTGTGACC 0: 1
1: 0
2: 1
3: 4
4: 107
Right 1177164545 21:17585409-17585431 ATATCATAATACAACAGTATAGG 0: 1
1: 0
2: 2
3: 22
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177164543 Original CRISPR GGTCACACAATTCGAAAACA TGG (reversed) Intronic
905509052 1:38503944-38503966 GGAAAGACAATTAGAAAACAAGG + Intergenic
905767869 1:40617576-40617598 GATAACACAAATGGAAAACAAGG - Intergenic
907195038 1:52679615-52679637 GGTGACAAAATCCGAAAAGAGGG + Intergenic
908637419 1:66183674-66183696 GGGCACAGGATTGGAAAACATGG - Intronic
909851833 1:80475976-80475998 AGTCAAACCATTAGAAAACAAGG + Intergenic
909941819 1:81619874-81619896 GGTCACACACCTGGTAAACAAGG - Intronic
919318940 1:196009342-196009364 GGTTACACATTTTGAGAACAAGG - Intergenic
919763010 1:201110221-201110243 GGCCACACAATTGGCAAAGATGG + Exonic
921137239 1:212272756-212272778 GGTCACCCAATTCAAAACCTTGG + Intergenic
924764594 1:247020583-247020605 TGTCACACAATGAGAACACATGG - Intergenic
1062895142 10:1097562-1097584 GCTCCCACACTTCGAAACCAAGG - Intronic
1071208862 10:83314896-83314918 GGGCACAGAATTGCAAAACAAGG + Intergenic
1079277996 11:19059600-19059622 GGTCAAACAATTAAAAAAAAGGG + Intronic
1082718700 11:56646750-56646772 AGTCACACAATCAGAAGACATGG - Intergenic
1085822919 11:79812176-79812198 GGTCACACAGTTGGAAAATGAGG - Intergenic
1093954050 12:25195987-25196009 GGTCTCATAATGCTAAAACAGGG - Intronic
1098153120 12:67568748-67568770 GGTCAGGCAATTCAAGAACATGG + Intergenic
1099580246 12:84436802-84436824 GGTCACAGAATTAAAAAAGAAGG - Intergenic
1100910014 12:99348994-99349016 GGGGACACAATGTGAAAACATGG + Intronic
1101765731 12:107697495-107697517 GGTCCCACACTTCAATAACAGGG - Exonic
1102846342 12:116188250-116188272 GCTCAAACTATTCAAAAACATGG - Intronic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1109141622 13:58719431-58719453 TGTCACTCAATTCTCAAACATGG - Intergenic
1117295270 14:54373230-54373252 GGACAAAAAATTCGAAAAAAAGG + Intergenic
1127273512 15:57422342-57422364 AGTCACACCATTAGAAATCATGG - Intronic
1127545413 15:59990119-59990141 GGTCACACAATAGCAAAGCAGGG - Intergenic
1131433256 15:92403214-92403236 GGTCACACAGCTAGTAAACATGG + Intronic
1135493710 16:22933088-22933110 GGTCACAGAAATAGAAAAAATGG + Intergenic
1138737487 16:59267168-59267190 GGTCACACAACTAGTAAAAAAGG + Intergenic
1140975816 16:80059186-80059208 TGTCACATAATTAGAAAATAAGG + Intergenic
1151540192 17:74760847-74760869 GGTCACACAGCTCCTAAACAGGG + Intronic
1151886731 17:76927014-76927036 GGGCACACAGTTCCAGAACACGG + Intronic
1152841447 17:82571270-82571292 AGTAATACAATTCGAAAACATGG - Intronic
1153610221 18:6877367-6877389 GGTCAGACAATTCCTAACCATGG + Intronic
1156034984 18:32755997-32756019 AGACACAAAATTAGAAAACAGGG - Intronic
1156693696 18:39740124-39740146 GCTCACATAATCAGAAAACATGG + Intergenic
1162036638 19:7943648-7943670 GGTCACACGATTCTCCAACATGG - Exonic
1162083099 19:8231212-8231234 TCTCACAAAATTGGAAAACATGG - Intronic
925008609 2:465620-465642 GGTCACATAATTTGGAAACCAGG + Intergenic
927130666 2:20055965-20055987 GGCCAGACAATTGGAAAATAGGG + Intergenic
931243245 2:60471155-60471177 GGTCTCACAATTGGAAAACAAGG + Intronic
931788001 2:65639004-65639026 GATCACAAAATTTGTAAACAGGG + Intergenic
932982031 2:76681016-76681038 GGTGAAACAATTTGAAAACTGGG + Intergenic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
937269226 2:120637348-120637370 CTTCAGACAATTGGAAAACATGG + Intergenic
940097412 2:149993331-149993353 GGACACACTATTCCAAAATATGG - Intergenic
942860825 2:180609630-180609652 GGTCACACAGCTTGAAAGCAAGG - Intergenic
943311087 2:186325714-186325736 GGACACACTACTCCAAAACACGG + Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1170728954 20:18955669-18955691 GGTCACACCAGTCGACAGCATGG - Intergenic
1170965163 20:21061787-21061809 GACCACACAATTCGAAAAAATGG - Intergenic
1171303277 20:24082820-24082842 GTTCACACAGTTAGAAAATACGG + Intergenic
1173458254 20:43221161-43221183 GGTCACACAGTTGGTAAGCAGGG - Intergenic
1177164543 21:17585368-17585390 GGTCACACAATTCGAAAACATGG - Intronic
953760663 3:45684349-45684371 GGACACCCAATTTGAAAACTCGG + Exonic
955707403 3:61742676-61742698 GCTCACACACAACGAAAACATGG - Intronic
955962768 3:64357917-64357939 GGTCACATATTTTTAAAACAAGG - Intronic
959679994 3:109084219-109084241 GGTCACATCATTCTGAAACAAGG - Intronic
959834488 3:110902663-110902685 GTTCACTCAATACGAAACCACGG + Intergenic
959935988 3:112029010-112029032 GCTGACACAATTCTTAAACAAGG + Intergenic
972654482 4:41051420-41051442 GGTCACAAAGTAGGAAAACAGGG + Intronic
978545140 4:109863320-109863342 GGTCACACAATTGGACAGCCAGG - Intronic
983684822 4:170396076-170396098 GGTCACACAACTAGCAAGCAGGG - Intergenic
984021508 4:174489234-174489256 TTTCACACACTTTGAAAACATGG + Intergenic
984055176 4:174919490-174919512 GGTCTCACAAGCCGAAATCAAGG + Intronic
984869924 4:184316819-184316841 GGTCTCAGAATTCTAAACCAGGG - Intergenic
989223065 5:38991034-38991056 GGTCACAGAACTAGGAAACAAGG + Exonic
990552876 5:56901585-56901607 GGTCAGACCATTAAAAAACATGG - Intergenic
990561032 5:56983016-56983038 GGTCACACAATCCGATAGAAAGG + Intergenic
991462718 5:66876504-66876526 GTACACACAATTTGAAAATAGGG - Intronic
993010890 5:82481090-82481112 GGACACAAAATTTGAACACAGGG - Intergenic
993354079 5:86884449-86884471 GCTCACACACAACGAAAACATGG - Intergenic
993683212 5:90905659-90905681 GATCACATAATTTGCAAACAAGG + Intronic
1000508394 5:162150368-162150390 AGTGCCACAATTTGAAAACAGGG + Intronic
1001034668 5:168289199-168289221 GGTCACACAGCTAGAAAACCGGG + Intergenic
1003635740 6:7829835-7829857 GGTCACCAAATCCGGAAACATGG + Intronic
1004275468 6:14231783-14231805 TGTCAAAGAATTAGAAAACATGG + Intergenic
1004837620 6:19546092-19546114 TGCCACACAATATGAAAACAAGG + Intergenic
1006637394 6:35470279-35470301 GCTCACACACAACGAAAACATGG + Exonic
1009935771 6:70232852-70232874 GGTGACACATTTAGAAAAAAAGG - Intronic
1012392031 6:98752506-98752528 AGTCAAACAATGAGAAAACATGG - Intergenic
1014668920 6:124274770-124274792 GGACACACTATTCAAAAAAAAGG + Intronic
1018193361 6:161331200-161331222 GGTAACACAATACAAAAGCAAGG - Intergenic
1020269755 7:6587667-6587689 GGTCACACAATGGGAAAACGAGG - Intronic
1022591113 7:31664065-31664087 TGTCACACAACTAGAAAACCAGG + Intergenic
1023712377 7:43008691-43008713 GGTCACCCATTTCCCAAACAAGG + Intergenic
1024800133 7:53067460-53067482 GTTCATACAGTTCTAAAACAGGG + Intergenic
1024920440 7:54548355-54548377 GGTCACACAGTGGGTAAACAGGG - Intronic
1026410965 7:70122429-70122451 GGTGACACAATTAGTAGACAAGG - Intronic
1027471696 7:78582110-78582132 GGACACACTACTCAAAAACATGG - Intronic
1027810038 7:82884703-82884725 TGTCACAAAATTGGAAAATAGGG + Intronic
1031127699 7:117793235-117793257 GGTAATACAATTAGCAAACATGG - Intronic
1034075157 7:148224612-148224634 AGTTACACATTTTGAAAACATGG + Intronic
1036380884 8:8235830-8235852 GGTCACACTCTCCGAAAGCATGG + Intergenic
1037390000 8:18383495-18383517 GCTCACACACAACGAAAACATGG - Intergenic
1045754947 8:105531563-105531585 TGTCACACTATTTGGAAACAGGG - Intronic
1047288749 8:123510662-123510684 AGGAACACAATTGGAAAACATGG - Intronic
1050592784 9:7177397-7177419 GGTCACAGTATGTGAAAACATGG + Intergenic
1051982531 9:23040304-23040326 GGAAACACAAGTAGAAAACAAGG - Intergenic
1057503525 9:95614829-95614851 GGACACACAATTCTACAACTTGG - Intergenic
1058568892 9:106319411-106319433 TGTCACAGAATCCAAAAACAAGG - Intergenic
1059479342 9:114576281-114576303 GGTCACAAATTTCGAAGGCAGGG + Intergenic
1061251536 9:129429116-129429138 GGTCACACAGCTAGAAAAGAAGG + Intergenic
1062021564 9:134321974-134321996 GGTAACAGACTTGGAAAACAAGG - Intronic
1187550108 X:20293703-20293725 GGACACACTATCCCAAAACATGG - Intergenic
1190130387 X:47742605-47742627 GTTCACCCAATTGGAACACAGGG - Intergenic
1190268683 X:48845555-48845577 AGTCACACAATTGGAAAAGGTGG + Intergenic
1191926900 X:66322646-66322668 GATCATACAATCCGCAAACAAGG - Intergenic
1192566358 X:72167131-72167153 GGTTACACAAATCTACAACATGG + Intergenic
1192879985 X:75273785-75273807 GGTCACAAAGTCTGAAAACATGG + Intergenic
1199174620 X:144771947-144771969 GCTCACATAATTTGCAAACAAGG + Intergenic
1200388688 X:155919660-155919682 GGTGACACCACTCGAAAACAAGG - Intronic