ID: 1177165860

View in Genome Browser
Species Human (GRCh38)
Location 21:17603000-17603022
Sequence TGTCATGTGGTCTGACATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177165860 Original CRISPR TGTCATGTGGTCTGACATAG AGG (reversed) Intronic
901359830 1:8687776-8687798 TTTACTGTGGTCTGACATAAGGG - Intronic
902173931 1:14635297-14635319 TGTCCTGTGCACTGGCATAGGGG + Intronic
903384104 1:22915645-22915667 TGTCAGGTGAGCTGTCATAGTGG + Intergenic
905937765 1:41838428-41838450 TGCCATGTGGTCTGAAAGTGTGG - Intronic
906673157 1:47674905-47674927 TGTCATGGTGTCTGACACAGAGG - Intergenic
907070426 1:51529774-51529796 TGGCATCTGGTATGACGTAGGGG - Intergenic
907627188 1:56041734-56041756 TTTTATGTGTTCTCACATAGTGG + Intergenic
908174071 1:61536931-61536953 TGTGATGTGGTATCTCATAGTGG + Intergenic
911253889 1:95611981-95612003 TGTGATGTGGTATGAGAGAGAGG - Intergenic
912407744 1:109454950-109454972 TGACAGGTGGTCTGAAATACAGG - Intergenic
914449791 1:147780960-147780982 TGTCATATGCTCTGGGATAGAGG + Intergenic
918779601 1:188681757-188681779 TAGCATGTGGTATGAGATAGGGG + Intergenic
919015500 1:192028404-192028426 TGTGCTGTGGTCTGAGAGAGTGG + Intergenic
919544640 1:198899704-198899726 TGTCAAGTGGTCAGACAGACTGG - Intergenic
1067667753 10:48292768-48292790 TGTTATGTGGTCTGAATCAGTGG + Intergenic
1068256062 10:54512956-54512978 TGTCATGTGGTATGATTTAATGG - Intronic
1068836225 10:61557083-61557105 TGTGAGGTGGTATGTCATAGTGG - Intergenic
1072835985 10:98712627-98712649 TATCATGTGGTCTGCCGTGGTGG + Intronic
1075828486 10:125382323-125382345 TGTGCTGTGGTCTGACAGTGTGG + Intergenic
1077708812 11:4515334-4515356 TGGCATGTGGTGTGACACAAGGG - Intergenic
1080040203 11:27752146-27752168 TGCCATGTGGACTGACACAAAGG - Intergenic
1083907550 11:65683195-65683217 TGTCATGTAGTCTCATACAGAGG + Intergenic
1085760291 11:79235450-79235472 AGTCATGCGGCCTGACACAGGGG + Intronic
1087310022 11:96530413-96530435 TGCCATGTGGTCTGAAAGAGTGG - Intergenic
1087430827 11:98052249-98052271 TGTCATATGGCCTGCCATTGTGG - Intergenic
1088217345 11:107526317-107526339 TGGCATGTGGTATGAAATTGTGG + Intronic
1089562068 11:119348392-119348414 TGACATGTGATATGACATTGGGG + Intergenic
1090446992 11:126772942-126772964 TGTCATGTGGACTAAGGTAGGGG + Intronic
1091850180 12:3690505-3690527 TGTGCTGTGGTCTGACAGAGTGG + Intronic
1093497726 12:19776989-19777011 TGCCCTGTGGTCTGAGATTGTGG + Intergenic
1095285699 12:40407810-40407832 TGTAATGTGGTCTCACCTGGAGG + Intronic
1098725499 12:73960015-73960037 TGTCATTTGGGCAGACACAGAGG - Intergenic
1105411198 13:20173342-20173364 TGTAAGGTGGGCTGTCATAGCGG - Intergenic
1105838276 13:24230128-24230150 TGTAATTTGGTTTGATATAGAGG + Intronic
1106044755 13:26128588-26128610 TGTCATTTTGTTTGACATATTGG - Intergenic
1107232914 13:38132330-38132352 TGTGCTGTGGTCTGACAGTGTGG + Intergenic
1109100442 13:58177876-58177898 TGTTTTGTGGTCTTACATATGGG + Intergenic
1113260935 13:108562199-108562221 TGTCATGTGAGATGACATTGAGG - Intergenic
1114336473 14:21696423-21696445 TTTCATATGGTATGAGATAGAGG - Intergenic
1114760081 14:25304143-25304165 TGTGCTGTGGTCTGAGAGAGTGG - Intergenic
1117581097 14:57152579-57152601 TGAAATGTGTTCTAACATAGGGG + Intergenic
1118975912 14:70676574-70676596 TGTCACATGGTTTGAAATAGTGG - Intergenic
1119586601 14:75841513-75841535 TGTCATCTGGTCTGACTTTCTGG + Intronic
1119791395 14:77353237-77353259 TGTCTTGTTGTCTTACACAGAGG - Intronic
1120137983 14:80892837-80892859 TGTGATGTGGTATCTCATAGTGG - Intronic
1120204146 14:81569486-81569508 TTCTATGTGGTCTGACAGAGTGG - Intergenic
1120805840 14:88748938-88748960 TATCAAGTGGTCTAACATACAGG + Intronic
1123069804 14:105637202-105637224 TGTGATGTGGTGTGACATGGTGG - Intergenic
1123074466 14:105661077-105661099 TGTGATGTGGTGTGACATAGTGG - Intergenic
1133016794 16:2946792-2946814 TGTGAAGTGGTCTGTCACAGTGG - Intronic
1140570352 16:76098151-76098173 TGTGATGTGGTATTACATTGTGG + Intergenic
1144079212 17:11747401-11747423 TGTCAGGAGGTCTGAAATATAGG - Intronic
1156481715 18:37440494-37440516 GGACATCTGGTCTGACATGGAGG - Intronic
1158822420 18:61176696-61176718 TGTAATGTGGTCTGAGAGTGTGG - Intergenic
1160062111 18:75540320-75540342 TATCATGTGGCTTGACCTAGTGG - Intergenic
1164392815 19:27840596-27840618 TGTCATCTGGTGTCACCTAGAGG + Intergenic
1165980783 19:39720921-39720943 TTTCATGTGGTTTGACAGATTGG - Intergenic
1168479302 19:56705217-56705239 TTTTATGTGGTCAGAGATAGGGG - Intergenic
930281753 2:49377772-49377794 AGTCCTGTGGTCTGACATAATGG - Intergenic
934739105 2:96706374-96706396 TGTCATGTGGTCTGACCATGTGG - Exonic
935637367 2:105259679-105259701 TGTCATCTGCTCTGACCTACAGG + Intergenic
937499848 2:122466444-122466466 TGTCATGTGTTATGAATTAGAGG + Intergenic
937860937 2:126708508-126708530 TGTCATGTAATCTGAGAAAGGGG - Intergenic
940516788 2:154693535-154693557 TGTCACGTGGTATGTCACAGTGG + Intergenic
941252264 2:163180493-163180515 TGTCATATATTCTGAAATAGTGG + Intergenic
942439400 2:176016886-176016908 TGTCATATGATCTGTCACAGAGG - Intergenic
945307553 2:208273019-208273041 TGTAATGTGGTATGACAAATGGG - Intronic
946115545 2:217458811-217458833 TTACATGTGGCCTGACATAAAGG - Intronic
1171195026 20:23190091-23190113 TGCCATGTGGCCTCACATCGAGG - Intergenic
1177165860 21:17603000-17603022 TGTCATGTGGTCTGACATAGAGG - Intronic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
951128399 3:19011882-19011904 TGTCATATCATATGACATAGAGG + Intergenic
953217483 3:40933762-40933784 TGTTATGTGGCCTAACATATGGG - Intergenic
953295206 3:41708437-41708459 TATCATGTGGTCTCACTTACAGG + Intronic
954480335 3:50794078-50794100 TGTGCTGTGGTCTGACAGAGTGG + Intronic
956108615 3:65848155-65848177 AGACACGTGGTCTGACAAAGTGG - Intronic
958048704 3:88318253-88318275 TGTCATCAGGACTGACAGAGAGG + Intergenic
958454792 3:94317312-94317334 TCTCATGTGATCTGAAATACTGG - Intergenic
959726497 3:109548789-109548811 AGGCATGTGGATTGACATAGAGG - Intergenic
959960282 3:112290400-112290422 TGTGCTGTGGTCTGAGAGAGTGG + Intronic
962633586 3:137305295-137305317 TGTCTTGAATTCTGACATAGAGG - Intergenic
963113779 3:141708459-141708481 TTTCATGTGGTCTGACTGCGTGG - Intergenic
963393764 3:144705062-144705084 TGTTATGTGGCCTAACATAATGG + Intergenic
965075498 3:163969623-163969645 TGTTATGTGGTGAGACATAGAGG - Intergenic
966216295 3:177506646-177506668 TTTCCTGGGGTCTGACATAAAGG + Intergenic
966553059 3:181227311-181227333 TATCATGTGGTCTCTCATGGAGG + Intergenic
968545729 4:1196878-1196900 TGTCCTCTGGTCTGACTCAGAGG - Intronic
970869683 4:20800714-20800736 TGTGACTTGGTCTGACTTAGAGG + Intronic
971481187 4:27116421-27116443 GGTCATGTGGTCAGAGAGAGTGG + Intergenic
971635281 4:29048772-29048794 TGTCATGTATTCTGTTATAGGGG + Intergenic
971708303 4:30077387-30077409 TGAGCTGTGGTCTGACAAAGTGG + Intergenic
972169610 4:36329136-36329158 TGACAGGCGGTATGACATAGTGG - Intronic
972470722 4:39401572-39401594 TTCCATGTGGTCGGACACAGTGG + Intergenic
972820228 4:42693397-42693419 TGAGATGTGGTATGACAGAGGGG + Intergenic
974723028 4:65766567-65766589 TGTGCTGTGGTCTGAGAGAGTGG + Intergenic
975770758 4:77719807-77719829 TGTCATGTGGTGTTACATGCTGG + Exonic
979076512 4:116277453-116277475 TGTGCTGTGGTCTGAGAGAGTGG - Intergenic
981429673 4:144645465-144645487 TTTCTTGGGGTCTGACTTAGAGG - Intergenic
982425370 4:155252329-155252351 TGTCATGCTGTTTGCCATAGTGG - Intergenic
983504078 4:168533638-168533660 TGGCCTGTGGTCTGAAATGGGGG + Intronic
984319816 4:178179713-178179735 TTTCATATGGTTTGAAATAGGGG - Intergenic
987269924 5:16296563-16296585 TGTGCTGTGGTCTGAAAGAGTGG + Intergenic
987484561 5:18508472-18508494 TGTGCTGTGGTCTGACAGTGTGG - Intergenic
987981651 5:25093664-25093686 TGTCTTATGGTCTGTCACAGAGG + Intergenic
988163304 5:27549529-27549551 TGTAATGTGGTCTGAGAGTGTGG + Intergenic
988837719 5:35049221-35049243 TGTCCTGTGGTTGGACAGAGGGG + Intronic
991504165 5:67306731-67306753 TTTCATGGGGCCTCACATAGAGG - Intergenic
993796216 5:92270761-92270783 TGTTCTGTGGTCTGATAGAGTGG - Intergenic
994359118 5:98830199-98830221 TGTGCTGTGGTCTGAGAGAGTGG - Intergenic
997516363 5:134492582-134492604 TGTCCTGTGGTCTCCCAAAGTGG + Intergenic
999735784 5:154511780-154511802 TGACATGTGGTCTGACAATGGGG + Intergenic
999796751 5:154995913-154995935 CCCCATGTGGTCTGACATGGGGG + Intergenic
999852207 5:155553759-155553781 TGACATGTGGTATTACAGAGAGG + Intergenic
1001166050 5:169368540-169368562 TATCATGTGGTCTATCTTAGAGG - Intergenic
1003617101 6:7664992-7665014 TGTGATGTGGTCTCTCATTGTGG + Intergenic
1008327898 6:50207360-50207382 TGAGATGTGCTATGACATAGTGG + Intergenic
1008795339 6:55295832-55295854 TGTGATGTGTTATGGCATAGAGG - Intergenic
1009500034 6:64400881-64400903 TGTCATTTGGACTGACATAACGG + Intronic
1009580835 6:65531519-65531541 TTTCATGTAGTCTGACTTTGGGG - Intronic
1013080961 6:106812236-106812258 TGCTCTGTGGTCTGACAGAGTGG - Intergenic
1014525478 6:122496184-122496206 TGCCATGTGGTTTGACCTACAGG - Intronic
1016423487 6:143910310-143910332 TGTGCTGTGGTCTGACAGACTGG + Intronic
1019961424 7:4463032-4463054 TGTCATGAGGTCGGGCATTGTGG - Intergenic
1020415182 7:7937455-7937477 TGGCATGTGGTGTGAGATAGGGG - Intronic
1020587194 7:10083794-10083816 TGTAATGTGTTGTGACATAATGG - Intergenic
1020963510 7:14836175-14836197 AGGCATGTGGTGTGACTTAGTGG - Intronic
1021405446 7:20262353-20262375 TGACATGTTCTCTGACATGGAGG + Intergenic
1021425886 7:20498657-20498679 TGTGCTGTGGTCTGAGAGAGTGG - Intergenic
1022721887 7:32948820-32948842 TGTCATGTAGACTGACAGTGGGG + Intergenic
1032836391 7:135679152-135679174 TGTCCTATTGTCTGACTTAGGGG + Intronic
1033680032 7:143584584-143584606 TGTCAAGTGGTCTGGCTCAGTGG + Intergenic
1033691802 7:143744858-143744880 TGTCAAGTGGTCTGGCTCAGTGG - Intergenic
1041034922 8:53779259-53779281 TGTCTTATAGTCTGTCATAGTGG - Intronic
1041378707 8:57229148-57229170 TGTCATGTGTTCTGAGCAAGAGG - Intergenic
1041854048 8:62429002-62429024 TGTAATATGGTGAGACATAGGGG + Intronic
1048206960 8:132423088-132423110 TTTGATGTGGTCTGACAAAATGG + Intronic
1048385145 8:133905147-133905169 TATCTTGAGGTCTGACATGGGGG + Intergenic
1050302378 9:4272822-4272844 TGTCAGGTGATCTGACATTCTGG + Intronic
1052553609 9:29985056-29985078 TGTCCTGTGGTCTGCCATACAGG - Intergenic
1053298410 9:36931379-36931401 TGTCATGTGGCCAGTGATAGAGG - Intronic
1058315243 9:103556772-103556794 TGTGCTGTGGTCTGAGAAAGCGG - Intergenic
1062512719 9:136916237-136916259 TGTCCTGTGGACTGTGATAGAGG + Intronic
1186767908 X:12790580-12790602 TGTGATGAGGACTCACATAGTGG + Intergenic
1186819113 X:13268713-13268735 TGTTATGTAGTCTAACACAGTGG + Intergenic
1186869379 X:13755055-13755077 GGTCATTAGGTCTGACATACTGG + Intronic
1187726720 X:22210917-22210939 CCTCATGTGTTCTGACATGGAGG + Intronic
1192715784 X:73641187-73641209 TGTGCTGTGGTCTGAGATTGTGG + Intronic
1193617438 X:83707253-83707275 TGTCATGTGGTCTATCTTGGAGG + Intergenic
1195270397 X:103223106-103223128 TGTACTGTGGTCTGAGAGAGTGG - Intergenic
1197362042 X:125516135-125516157 TTTAATATGGTGTGACATAGGGG - Intergenic
1197406716 X:126062777-126062799 TGTGCTGTGGTCTGAGACAGAGG - Intergenic
1197920823 X:131591899-131591921 TGGCATGTGCTCTAACAGAGGGG + Intergenic
1199120734 X:144050478-144050500 TGTGCTGTGGTCTGAGAGAGTGG - Intergenic
1201758082 Y:17511635-17511657 TGTCAGTTGGTATGACATTGTGG - Intergenic
1201843473 Y:18394355-18394377 TGTCAGTTGGTATGACATTGTGG + Intergenic
1201848914 Y:18455054-18455076 GGTCATTAGGTCTGACATACTGG - Intergenic
1201884404 Y:18865321-18865343 GGTCATTAGGTCTGACATACTGG + Intergenic
1202351129 Y:23993133-23993155 GGTCATTAGGTCTGACATACTGG + Intergenic
1202519650 Y:25676985-25677007 GGTCATTAGGTCTGACATACTGG - Intergenic