ID: 1177166769

View in Genome Browser
Species Human (GRCh38)
Location 21:17612637-17612659
Sequence CTGTGGGTATCGGGGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 562}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177166769_1177166781 2 Left 1177166769 21:17612637-17612659 CCACCCTCCCCCGATACCCACAG 0: 1
1: 0
2: 4
3: 39
4: 562
Right 1177166781 21:17612662-17612684 CCGCCATGTCTGCCTTTCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 219
1177166769_1177166783 7 Left 1177166769 21:17612637-17612659 CCACCCTCCCCCGATACCCACAG 0: 1
1: 0
2: 4
3: 39
4: 562
Right 1177166783 21:17612667-17612689 ATGTCTGCCTTTCCCCGGCCCGG 0: 1
1: 0
2: 0
3: 17
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177166769 Original CRISPR CTGTGGGTATCGGGGGAGGG TGG (reversed) Intronic
900120686 1:1047490-1047512 CTCTGGGTATCTGGGGAGGAAGG - Intronic
900825271 1:4921158-4921180 GTGTGGGTCTCGGGGGAGGATGG + Intergenic
901469948 1:9449352-9449374 CTGCGGGTGGCGGGGGCGGGAGG + Intergenic
902515294 1:16986663-16986685 CTGTGGGTGCCGGGGGGGCGTGG - Intronic
903140473 1:21335909-21335931 CAGTGGGTCTCCAGGGAGGGAGG + Intronic
903580308 1:24365811-24365833 CTGTGGGCCTGGGGGAAGGGAGG - Intronic
903957126 1:27033255-27033277 GTTTGGGTACCGTGGGAGGGAGG + Intergenic
904034041 1:27549724-27549746 CTGTGGGTTTCAGGGGACCGAGG - Exonic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
905282964 1:36860670-36860692 CTCTGGGTCTGGGGGCAGGGTGG + Intronic
905387591 1:37614977-37614999 CTGGGGGAATGGGGGCAGGGTGG + Intronic
905972520 1:42152899-42152921 ATGTGGGTCTTGGGGGAGTGGGG + Intergenic
905975314 1:42170009-42170031 CTGTGGGAATGGGGGGACTGAGG - Intergenic
906130064 1:43450658-43450680 CTGTGGGTGTTTGGGGAGGGCGG - Exonic
906146164 1:43561913-43561935 CTGTGAGTATAGGGGCAGGGGGG - Intronic
906808235 1:48800995-48801017 CTGTGGGGCATGGGGGAGGGTGG + Intronic
906979306 1:50611829-50611851 GTGTGGGTATGTGGGGAGGTTGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907559722 1:55377573-55377595 CTGTGGGTATGGGAGCTGGGAGG - Intergenic
907751878 1:57270773-57270795 CAGTGAGTATTGGTGGAGGGAGG - Intronic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908754200 1:67453023-67453045 CTATTGCTATGGGGGGAGGGGGG + Intergenic
910121925 1:83799606-83799628 GTGTGTGTGTTGGGGGAGGGAGG + Intergenic
910209636 1:84779881-84779903 CTGTGGGTCTTGGAGGAGGTTGG - Intergenic
911255379 1:95627482-95627504 GTGTGGGAGTCAGGGGAGGGAGG + Intergenic
911812917 1:102307306-102307328 TTGTGGGGGTCGGGGGAGGGTGG - Intergenic
912255170 1:108050986-108051008 CTGTGGGGAATGGGGGATGGAGG + Intergenic
912713236 1:111964417-111964439 CTGTGGGGGCCGGGGGAGGGAGG - Intronic
913088346 1:115459212-115459234 GTGTGTGTGTTGGGGGAGGGTGG - Intergenic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
914530771 1:148522487-148522509 CTGTGGGTGGTGGGGGGGGGGGG + Intergenic
915348286 1:155209057-155209079 CCGCGGGCCTCGGGGGAGGGCGG - Exonic
915530458 1:156499949-156499971 GTTTGGGAAGCGGGGGAGGGAGG - Intronic
915546644 1:156602640-156602662 CTGTGGGAGTGAGGGGAGGGCGG + Intergenic
915769684 1:158407294-158407316 GTGTGTGTGTCGGGGGACGGGGG + Intergenic
915907474 1:159889399-159889421 GTGTGTGTGTTGGGGGAGGGTGG + Intronic
916697405 1:167253377-167253399 CTGTGTGTTTGGGGGGGGGGGGG - Intronic
917329617 1:173868266-173868288 CTCTGGGGATGGGGGAAGGGGGG + Intronic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
917931259 1:179824373-179824395 CTGTTGGTGTGGGGAGAGGGGGG - Intergenic
920039548 1:203086388-203086410 TGGTGGGTATAGGGGGAGGAGGG + Intergenic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
921882580 1:220271920-220271942 GTGTGGGGGTGGGGGGAGGGAGG + Intronic
922108492 1:222533426-222533448 ATGTGTGTATGGGGGCAGGGTGG + Intronic
922566697 1:226605827-226605849 CTGAGGGTGTTGGGGGATGGCGG + Exonic
922804016 1:228376624-228376646 CTGGGGGTATGGGGACAGGGAGG - Intronic
922905411 1:229170234-229170256 GAGCGGGTATCAGGGGAGGGTGG - Intergenic
923014733 1:230118014-230118036 CAGTGGTTATCGGGGTTGGGAGG - Intronic
923018055 1:230142153-230142175 CTGTGGAGGTGGGGGGAGGGTGG + Intronic
923206707 1:231766044-231766066 CTTTGGGAAGCGGAGGAGGGAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923651281 1:235876318-235876340 CTGTGGGAAGCAGGAGAGGGAGG - Intronic
923689057 1:236175653-236175675 ATGGGGGAATCAGGGGAGGGGGG - Intronic
923857950 1:237864874-237864896 CTGTGGGAGGCAGGGGAGGGAGG - Intergenic
923899927 1:238314587-238314609 GTGTGTGTGTCGGGGGGGGGGGG + Intergenic
924448479 1:244156294-244156316 CAGTGGGTAGAGGGTGAGGGAGG - Intergenic
924923526 1:248656408-248656430 CTGGGGGGAGCGGGGAAGGGTGG + Intergenic
1063021550 10:2133990-2134012 CTGTGCGTGTGGGGGGATGGAGG + Intergenic
1063591179 10:7396901-7396923 GTGGGGGGATGGGGGGAGGGGGG + Intronic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1063761189 10:9078853-9078875 CAGTGGGTATCTGGGGTGGCTGG + Intergenic
1063943752 10:11157381-11157403 GTGTGTGTGTGGGGGGAGGGCGG - Intronic
1065581903 10:27180633-27180655 CTTTGGGTGGCTGGGGAGGGTGG - Intronic
1069244639 10:66188568-66188590 GTGTGTGTGTGGGGGGAGGGGGG + Intronic
1069515471 10:69073560-69073582 CTTTGGGAAGCGGAGGAGGGCGG + Intergenic
1069881806 10:71597936-71597958 CTGTGGGCAACTGGGAAGGGAGG + Intronic
1069986995 10:72291249-72291271 CTGTGGGCAGCTGGGGAGTGTGG + Intergenic
1070396129 10:76012452-76012474 GTGTGTGTATCGGGGGTTGGGGG + Intronic
1071197295 10:83175945-83175967 CTGGGGTTACTGGGGGAGGGGGG + Intergenic
1071550180 10:86560651-86560673 CAGTGGGGAGCTGGGGAGGGTGG - Intergenic
1073308315 10:102520622-102520644 CCAGGGGTTTCGGGGGAGGGAGG - Intronic
1073457499 10:103646537-103646559 CTGTGGGTGCTGGGGGTGGGAGG - Intronic
1073868208 10:107829777-107829799 CTGTGTGTGTCGGGGCGGGGAGG + Intergenic
1075223450 10:120603872-120603894 TTGTGTGTGTTGGGGGAGGGGGG - Intergenic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075945352 10:126428258-126428280 CTGTGGGTGTCTGGGGAGCTGGG + Intronic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077059931 11:613612-613634 CTGTGAGTGACGGGGGTGGGCGG + Intronic
1077059941 11:613642-613664 CTGTGAGTGACGGGGGTGGGCGG + Intronic
1077071537 11:676211-676233 CTGGGGGTATCGGGTGCTGGGGG - Intronic
1077077712 11:708925-708947 CGGTGGGGGTTGGGGGAGGGCGG - Intronic
1077428774 11:2503536-2503558 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
1077714325 11:4566452-4566474 CGGTGGGGGGCGGGGGAGGGGGG + Intergenic
1077860404 11:6172946-6172968 ATGTGGATACCTGGGGAGGGGGG + Intergenic
1078180420 11:9005665-9005687 CTGTGGGGGTAGGGGTAGGGGGG + Intergenic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078340850 11:10497138-10497160 CAGTGGGTGTGGGGGGATGGGGG + Intronic
1078822898 11:14900127-14900149 TTGTGGGTAGGGGGGGTGGGGGG - Intergenic
1079031523 11:16989793-16989815 ATGTGGGCATTGGGGGCGGGGGG - Intronic
1079070310 11:17339496-17339518 TTGTGGGGGTGGGGGGAGGGGGG - Intronic
1079272396 11:19000482-19000504 CTCTGGGTGCTGGGGGAGGGAGG - Intergenic
1080380645 11:31768856-31768878 CTGGGGGTGTGGGGGTAGGGAGG + Intronic
1082001385 11:47395315-47395337 CCGGGGGTCTCGGGGGATGGCGG - Intergenic
1083742165 11:64716783-64716805 CTGTGGATCCCGGGGGAGAGAGG - Intronic
1083780419 11:64914671-64914693 CTTTGGGTGACGGGGTAGGGGGG - Intronic
1083871096 11:65489036-65489058 CTGTGGGGAGCAGTGGAGGGAGG + Intergenic
1084263946 11:67995578-67995600 CTGTGGGCACTGGGGGGGGGGGG - Intronic
1084965964 11:72744726-72744748 ATGTGGGGGACGGGGGAGGGAGG - Intronic
1085048975 11:73369935-73369957 CTGGGGCTATCTGGGGAGGAAGG + Intergenic
1085758090 11:79218232-79218254 TTGTGTGTGTCGGGGGTGGGTGG - Intronic
1085779351 11:79394282-79394304 CTGTGGGGATGTGAGGAGGGTGG + Intronic
1086268189 11:85027884-85027906 ATGTGGTAAGCGGGGGAGGGGGG + Intronic
1086431395 11:86740137-86740159 ATCTGGGTATTGGAGGAGGGGGG - Intergenic
1086743720 11:90400213-90400235 GTGGTGGGATCGGGGGAGGGGGG - Intergenic
1087888681 11:103511447-103511469 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089563382 11:119357104-119357126 GGGTGGGTTTGGGGGGAGGGTGG + Intronic
1089676706 11:120095348-120095370 ATATGGGTATGGGGTGAGGGAGG + Intergenic
1091206806 11:133827134-133827156 CTGTAGGTATCTGGGGAAGGGGG - Intergenic
1091764128 12:3107182-3107204 CCGTGGGGAGTGGGGGAGGGAGG + Intronic
1092002968 12:5046123-5046145 ATGGGGGGATCGAGGGAGGGAGG - Exonic
1092040106 12:5376749-5376771 CTGTGGGTATCGGGGATGCTGGG - Intergenic
1092052417 12:5481033-5481055 GTGTGGGTGGCGGGGTAGGGAGG + Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092282478 12:7108531-7108553 CTGTGGGTGTGGGAGGAGCGGGG + Intronic
1093224340 12:16463432-16463454 CTCTGGGGGTGGGGGGAGGGAGG + Intronic
1096491684 12:52016082-52016104 GCTTGGGTATCTGGGGAGGGAGG - Intergenic
1096532210 12:52249219-52249241 CTCTGGGCATGGGGGGAGGGAGG - Intronic
1096616408 12:52835646-52835668 CTGTGGGGAACATGGGAGGGAGG - Intergenic
1096746781 12:53733896-53733918 CTATGGGAATCGGGGGAAGCGGG + Intergenic
1096785871 12:54017040-54017062 CTGGGGGCAGCTGGGGAGGGTGG + Intronic
1097402955 12:59151882-59151904 ATGTGTGTGGCGGGGGAGGGGGG - Intergenic
1099436502 12:82652575-82652597 CTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1099681602 12:85836614-85836636 GTGTGGAAAGCGGGGGAGGGGGG - Intergenic
1100605918 12:96152137-96152159 GGGAGGGTATCGGGGGATGGTGG - Intergenic
1100805504 12:98279002-98279024 GTGGTGGGATCGGGGGAGGGGGG + Intergenic
1100948377 12:99815649-99815671 CTGTGGGGACTGGTGGAGGGAGG - Intronic
1101519790 12:105470991-105471013 CTGGGGGTAACAGGGGAGGAAGG + Intergenic
1101841393 12:108329974-108329996 ATGTGAGTATTGGGGCAGGGTGG - Intronic
1102471243 12:113161088-113161110 CTGTGGGTGTGGGGGTTGGGTGG + Intronic
1102585685 12:113921288-113921310 CTATGTGTAACTGGGGAGGGAGG + Intronic
1102718505 12:114995856-114995878 GTGTGTGTGTCGGGGGCGGGGGG - Intergenic
1102877321 12:116458526-116458548 ATGGGGGTATGGGGGGTGGGGGG - Intergenic
1103564819 12:121810305-121810327 CTGTTGGTGTCGGGGGGCGGCGG - Exonic
1104728899 12:131094403-131094425 CTGTGGGCACCGGGGCAGGACGG + Intronic
1104920294 12:132287063-132287085 CTGTGGCTCACGGGGGGGGGGGG - Intronic
1104982826 12:132581844-132581866 GCGCGGGCATCGGGGGAGGGGGG - Intronic
1105260481 13:18775720-18775742 CAGTGGGAGTCGGGGGTGGGTGG - Intergenic
1105655219 13:22429424-22429446 GTGGGGGTATTGGGGGTGGGGGG - Intergenic
1105770422 13:23606030-23606052 TTGTGTGTGGCGGGGGAGGGCGG + Intronic
1105818306 13:24057226-24057248 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1106035579 13:26041698-26041720 CCGTGGGAATCTGGGGAGAGAGG - Intergenic
1106059048 13:26268244-26268266 GTGTGTGTGTTGGGGGAGGGGGG - Intronic
1108508593 13:51135123-51135145 CTGTGGCTGTCAGAGGAGGGAGG + Intergenic
1111962462 13:94826188-94826210 CTGGGGGTTTGGGGGGTGGGGGG - Intergenic
1112041587 13:95553036-95553058 CTGGGGGTATTGGGGGCGAGAGG - Intronic
1112426509 13:99306512-99306534 GTGTGTGTGTTGGGGGAGGGGGG - Intronic
1113645956 13:111996232-111996254 CTGTGGGAGCCGGGGGAGTGGGG - Intergenic
1114542245 14:23469801-23469823 CTGTTGGTACCAGGGAAGGGTGG + Intronic
1114836865 14:26212825-26212847 TTGTGTGTGTCGGGGGCGGGGGG - Intergenic
1115955083 14:38768682-38768704 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1116938583 14:50768410-50768432 CTGTTGTTATCTTGGGAGGGAGG + Intronic
1117460404 14:55939443-55939465 CTGTCTGTGTCGGGGGAGGAGGG + Intergenic
1117693850 14:58338912-58338934 TTGTGTGTATTGGGGGTGGGGGG - Intronic
1118249170 14:64142348-64142370 CTGTGGTTATTGGGGGTGGTGGG - Intronic
1118442838 14:65827713-65827735 ATGTGGGTGTCAGGGGAGGGAGG - Intergenic
1120071507 14:80108542-80108564 CTGTGGGTATCTGGTGACAGAGG - Intergenic
1120322376 14:82980705-82980727 CTGTGGGTTTCAGGGAAAGGGGG + Intergenic
1120519011 14:85504220-85504242 CTTTGGGTGTCCGGGGTGGGAGG + Intergenic
1120761327 14:88288421-88288443 CTGTGGGTGTCAGGGCAGGGTGG - Intronic
1121123843 14:91393328-91393350 CTGGGGGTTTAGGGGGTGGGGGG - Intronic
1121307399 14:92915661-92915683 CTATGGGGATGAGGGGAGGGTGG + Intergenic
1121414523 14:93770045-93770067 CTGTGGCTGTAGGGGGAGAGCGG - Intronic
1121765010 14:96478735-96478757 TTGTGGGGCTGGGGGGAGGGTGG + Intronic
1122278025 14:100605191-100605213 CTGTGGGTGTTGGGGAAGGGGGG + Intergenic
1122769813 14:104092958-104092980 CTGGGGGTGTGGGAGGAGGGTGG - Intronic
1122825741 14:104369572-104369594 ATGTGGGGATTGGGGGAGAGGGG + Intergenic
1122974693 14:105166275-105166297 CAGTGGGTGTGGGGGCAGGGAGG - Intronic
1123207966 14:106731979-106732001 TTGTGGGGGTTGGGGGAGGGGGG - Intergenic
1124116053 15:26843729-26843751 CAGTGGGTATCAGGGGTTGGGGG + Intronic
1124209683 15:27752806-27752828 CTGTGGGCCTCTGGGGGGGGGGG - Intergenic
1124639946 15:31391316-31391338 CTGTGGGTGTCGGGGTTGTGGGG + Intronic
1126070049 15:44858298-44858320 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1126282401 15:46970019-46970041 GTGTGTGTGTTGGGGGAGGGAGG - Intergenic
1126835937 15:52664934-52664956 CTCTGGGTGTTGGGGGTGGGGGG + Intronic
1127037886 15:54939392-54939414 CTGTCAGGATCGGGGGAGGGAGG - Intergenic
1127304140 15:57685502-57685524 CTGTGTGTGTCGGGGGAGGGTGG + Intronic
1127402537 15:58604116-58604138 CTGTGGGAAGCCGGGGCGGGTGG + Intronic
1127485290 15:59412805-59412827 CTCTGGGCATCGGGGTAGGAAGG + Intronic
1127856771 15:62960017-62960039 CTGTGGGGAGAGGGGGATGGGGG + Intergenic
1128283347 15:66415503-66415525 ATCTGGATATGGGGGGAGGGAGG - Intronic
1129129360 15:73479041-73479063 CTGTGGGAAGCGGGTGAGGCAGG - Intronic
1129709062 15:77811068-77811090 CTGTGGGAATTGGGGTGGGGGGG - Intronic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1129897039 15:79116151-79116173 CAGTGCGTATGGGGGGAGGGGGG - Intergenic
1130904070 15:88227753-88227775 AGGTGGGTAAAGGGGGAGGGAGG - Intronic
1131049023 15:89334430-89334452 GTGTGGGTCCCGGGGGACGGCGG - Intronic
1131387197 15:92017628-92017650 CTGTGGGTGGTAGGGGAGGGTGG + Intronic
1131865325 15:96702601-96702623 GTGTGGGTATGGGGGAGGGGCGG + Intergenic
1132019279 15:98346410-98346432 CTGATGGGCTCGGGGGAGGGAGG - Intergenic
1132550691 16:552776-552798 GTGGGGGTCCCGGGGGAGGGTGG + Intronic
1132552729 16:560088-560110 CTGCGGGCAACGGGGGCGGGAGG + Intergenic
1132589096 16:718581-718603 CTGTGGACACCTGGGGAGGGGGG + Exonic
1132600526 16:770718-770740 CTGGGGGGATGGGGTGAGGGGGG + Intronic
1132855468 16:2042844-2042866 CTGGGAGGATGGGGGGAGGGTGG - Intronic
1133212659 16:4272085-4272107 GTGTGGGTGTTGGGGGTGGGCGG - Intronic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1133726525 16:8542611-8542633 CTGTGGGTTTGGGGTGGGGGAGG + Intergenic
1133868466 16:9666059-9666081 ATGTGGATTTAGGGGGAGGGCGG - Intergenic
1133966017 16:10532186-10532208 CTGTAGGTCTGGGGTGAGGGGGG + Exonic
1134827105 16:17293730-17293752 CTTTGGGCATCCGAGGAGGGAGG - Intronic
1135304193 16:21354724-21354746 CTGTGGGCATGGGGGTGGGGAGG - Intergenic
1135964535 16:27024866-27024888 CTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1136270629 16:29146322-29146344 CTGTGGGGATGTGGGGATGGGGG + Intergenic
1136270639 16:29146352-29146374 CTGTGGGGATGTGGGGACGGGGG + Intergenic
1136270674 16:29146472-29146494 CTGTGGGGATGTGGGGATGGAGG + Intergenic
1136300934 16:29333861-29333883 CTGTGGGCATGGGGGTGGGGAGG - Intergenic
1136620579 16:31425922-31425944 CTGTGGGAAGCTGAGGAGGGTGG - Intronic
1138532727 16:57643549-57643571 CTGGCGGTATGGGGGGTGGGGGG + Intronic
1138809087 16:60127813-60127835 CTGTGGGAATTTGAGGAGGGAGG + Intergenic
1138989240 16:62370977-62370999 ATATGGTTCTCGGGGGAGGGGGG + Intergenic
1139185522 16:64801659-64801681 GTGTGTGTAGCGGGGGAGCGTGG - Intergenic
1139394587 16:66630324-66630346 CTGTGGGGAGAGGGAGAGGGAGG - Intronic
1139528688 16:67531029-67531051 CTATGGGACTCGGGGGATGGTGG + Intronic
1140255889 16:73336101-73336123 CTGTGTGTATCTGGGGCGGCAGG + Intergenic
1140449761 16:75061284-75061306 CTGGGGGTGTGGGGGGAGGTGGG - Intronic
1141148688 16:81549531-81549553 CTGTGTGTGTTGGGGGCGGGGGG + Intronic
1141163938 16:81647906-81647928 CTGCGGGTGCGGGGGGAGGGTGG - Intronic
1141163950 16:81647938-81647960 CTGCGGGTGCGGGGGGAGGGTGG - Intronic
1141163962 16:81647970-81647992 CTGCGGGTGTGGGGGGAGGGTGG - Intronic
1141163974 16:81648002-81648024 CTGCGGGTGCGGGGGGAGGGTGG - Intronic
1141473151 16:84252950-84252972 GTGTGTGTGTCGGGGGCGGGGGG + Intergenic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141493929 16:84393735-84393757 CTATGGGTGTGGGGGGAGTGGGG + Intronic
1141797886 16:86286946-86286968 CGGTGGGTTTCAGAGGAGGGAGG - Intergenic
1141988054 16:87592870-87592892 CTGTGGGGGAAGGGGGAGGGAGG + Intergenic
1142062634 16:88040590-88040612 CTGTGGGCATGGGGGTGGGGAGG - Intronic
1142074207 16:88108103-88108125 CTGTGGGGATGTGGGGATGGAGG + Intronic
1142074217 16:88108133-88108155 CTGTGGGGATGTGGGGATGGGGG + Intronic
1142074226 16:88108163-88108185 CTGTGGGGATGTGGGGATGGAGG + Intronic
1142074244 16:88108223-88108245 CTGTGGGGATGCGGGGAGGGGGG + Intronic
1142074253 16:88108253-88108275 CTGTGGGGATGTGGGGATGGAGG + Intronic
1142184616 16:88688594-88688616 GGGTGGGGATTGGGGGAGGGCGG + Intergenic
1142303053 16:89270122-89270144 CTGTGGGTATTTGGGGAGCGTGG - Intronic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142594092 17:1021147-1021169 CTGGGGGTCTCAGTGGAGGGGGG + Intronic
1142720910 17:1775203-1775225 CTGTAGGGATAGGGGCAGGGTGG + Intronic
1143304251 17:5933370-5933392 CTGGGATTGTCGGGGGAGGGGGG + Intronic
1143707785 17:8711532-8711554 CAGTGGGAATCAGGAGAGGGAGG - Intergenic
1145006753 17:19342745-19342767 CTGTGGGTAGGGGGGCAGAGAGG + Intronic
1145795202 17:27651414-27651436 GTGTGTGTGGCGGGGGAGGGGGG - Intergenic
1145994123 17:29095922-29095944 CTTTGGGTAAAGGGGTAGGGTGG + Intronic
1146937869 17:36823877-36823899 CTGTGGGTACAGGGGAAGGTGGG + Intergenic
1147193024 17:38748210-38748232 CGGTGGGTCTCGGGGAGGGGGGG + Exonic
1147211560 17:38875141-38875163 CTGTGGGGGTAGGGGGAGGCAGG + Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147426203 17:40346993-40347015 CTGCAGGTAAGGGGGGAGGGTGG + Intronic
1147512876 17:41086900-41086922 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
1147948769 17:44095509-44095531 CTGTGGGAATGGGGGTGGGGTGG + Intronic
1147965378 17:44191949-44191971 CTGGGGTCATTGGGGGAGGGGGG - Exonic
1148437480 17:47694875-47694897 CTGTGGGTGGCGGAGGGGGGGGG + Intronic
1148589684 17:48806510-48806532 CTGTGGACATCGGAGGAGAGGGG - Intronic
1148744060 17:49908657-49908679 CTGTGGGAATGGGGAGTGGGCGG + Intergenic
1148768728 17:50055044-50055066 CTTTGGGAACCCGGGGAGGGCGG - Intergenic
1148797540 17:50204214-50204236 CTGGGGGGATGGGGGGTGGGAGG + Intergenic
1149442473 17:56686206-56686228 ATGTGGGTTTAGGGGCAGGGGGG + Intergenic
1149546434 17:57507165-57507187 CTGTGTGTGTTGGGGGGGGGGGG + Intronic
1149979905 17:61302170-61302192 CCCTGGGAGTCGGGGGAGGGGGG - Intronic
1150229678 17:63543289-63543311 CTGTGCAGATCGCGGGAGGGAGG - Intronic
1150566026 17:66340942-66340964 CTGTGGGAATCAGAGGAGTGTGG + Intronic
1150630484 17:66877093-66877115 CTGCGGGGTTAGGGGGAGGGTGG + Intronic
1151379273 17:73713622-73713644 CTTTGGGAAACGGAGGAGGGAGG + Intergenic
1151979103 17:77498500-77498522 CTGTGGGGGTGGGGGGCGGGCGG - Intronic
1152077072 17:78166459-78166481 CTCTGGGTGTAGGGAGAGGGAGG + Intergenic
1152242581 17:79168034-79168056 GGGTGGGTAACTGGGGAGGGTGG + Intronic
1152443906 17:80329173-80329195 GAGTGAGTAGCGGGGGAGGGGGG - Intronic
1152636568 17:81432781-81432803 CTGGGGATGTGGGGGGAGGGTGG - Intronic
1152688086 17:81704425-81704447 CTGAAGGTATCGTGAGAGGGTGG + Exonic
1152691559 17:81720414-81720436 CTTTGGGCATCGGGGGCAGGAGG - Exonic
1152699238 17:81810987-81811009 CTGGGGGTGTGGGGGGAGGCTGG - Intronic
1152877438 17:82794981-82795003 CTGTGTGTAGCTGGGGACGGTGG + Intronic
1152926283 17:83089213-83089235 CAGTGGGTAGGGGTGGAGGGTGG - Intronic
1153762414 18:8344723-8344745 GTGTGAGTGTTGGGGGAGGGTGG + Intronic
1153871368 18:9323417-9323439 CAGTGTGTATTGGGGGAGGAGGG - Intergenic
1154411324 18:14143626-14143648 CTGTGGGCAGCGGGAGCGGGGGG + Intergenic
1154425536 18:14269075-14269097 CAGTGGGAGTCGGGGGTGGGGGG + Intergenic
1154948323 18:21183969-21183991 GTGTGGGGATGGGTGGAGGGAGG + Intergenic
1156021554 18:32605803-32605825 CTGGTGGGGTCGGGGGAGGGGGG - Intergenic
1157397488 18:47355016-47355038 CTGTGGGCATCAGCAGAGGGTGG + Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1158243691 18:55406733-55406755 TTGTGGGGATGGGGGGAGGCGGG - Intronic
1158504485 18:58034158-58034180 CTGTGTGTGTCAGGGGTGGGTGG - Intergenic
1159532388 18:69670966-69670988 GTGTGTGTGTTGGGGGAGGGAGG - Intronic
1160021719 18:75186640-75186662 CTCTGGGCAGCGGGGAAGGGAGG - Intergenic
1160745721 19:709902-709924 CTGTGTGTGTGGGGGGGGGGTGG + Intronic
1160967491 19:1753079-1753101 CTGTAGGGAACGGGGGGGGGGGG + Exonic
1161168603 19:2801981-2802003 ATGTGGGTATCGGGAGATGGCGG - Intronic
1161316324 19:3619243-3619265 CTGTGGGGAGCAGGGGAAGGTGG + Intronic
1162042709 19:7980179-7980201 CTGTGGGTATCTTGTGAAGGCGG + Intronic
1162246681 19:9407106-9407128 ATGAGGGCAACGGGGGAGGGGGG + Intergenic
1162796545 19:13090276-13090298 CTGTGGGGAGCAGGGGAGAGAGG - Intronic
1162798955 19:13100812-13100834 CAGTGGGGATCTGGGGTGGGGGG - Intronic
1162830403 19:13281135-13281157 CTCTGGGAATCTGAGGAGGGAGG + Intronic
1162923712 19:13919048-13919070 CTGGGGGTTCCGGGGGAGGTGGG + Intronic
1163078274 19:14915986-14916008 CTGGGAGAATTGGGGGAGGGGGG + Intergenic
1163158586 19:15452109-15452131 CTGTGGGGGTCGGGGGATTGGGG + Intronic
1163426100 19:17241773-17241795 CTTTGGGAGGCGGGGGAGGGTGG + Intronic
1164618420 19:29680172-29680194 CTGGGGGCATCGGGGTAGAGAGG + Intergenic
1165232246 19:34394434-34394456 CTGTTAGTATCTGGGGAGGAAGG + Intronic
1165773188 19:38389935-38389957 CTGTGGGTATGTGCTGAGGGAGG + Intronic
1166283584 19:41810448-41810470 CTGTGTGTTTTGGGGGAAGGTGG - Intronic
1166707243 19:44914796-44914818 ATGAGGGGATCGTGGGAGGGAGG + Intronic
1166709347 19:44926888-44926910 ATGAGGGGATCGTGGGAGGGAGG + Intergenic
1167007955 19:46787736-46787758 CTGGGGGTGTCGGGGGCCGGGGG - Exonic
1167203808 19:48086429-48086451 CTGTGGGTATCAGGGGGTGGGGG - Intronic
1167234577 19:48306226-48306248 CTGCGGGTATCCTGGGATGGCGG - Intronic
1167577598 19:50325301-50325323 CTGCGGGTAGTGGAGGAGGGAGG + Intronic
1167666217 19:50823910-50823932 CTCTGGGGATCGGAGGGGGGGGG - Intergenic
1168075201 19:53977579-53977601 CTGTGGGGATGGGGAGAGAGAGG - Intronic
1168314116 19:55476693-55476715 CTGTGGGGACCGGGGAGGGGGGG - Exonic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925636870 2:5949152-5949174 TTGTGTGTAGAGGGGGAGGGAGG + Intergenic
928414803 2:31083270-31083292 CTGTGGGGATCAGAGGGGGGTGG + Intronic
929033768 2:37672056-37672078 CTGTTGGGATCGGGAGAGGTGGG - Exonic
930751295 2:54937034-54937056 CTGTGGGAGGCGGAGGAGGGTGG + Intronic
930804214 2:55473919-55473941 CTGTGGGTAGAGGAGGAAGGGGG + Intergenic
931235728 2:60410920-60410942 CTGTGGGTGGGGGGGGGGGGGGG + Intergenic
931515922 2:63050665-63050687 GTGTGGGGGGCGGGGGAGGGCGG + Intronic
931757395 2:65386039-65386061 CTTTGGGAAGCGGGGGCGGGAGG + Intronic
932216482 2:69969528-69969550 CTGTGAGTATCCAGGGAGAGAGG - Intergenic
932477068 2:72013061-72013083 GTGTGTGTTTCAGGGGAGGGGGG - Intergenic
932479731 2:72031991-72032013 CTGTGGGTAACAGGAGAAGGAGG - Intergenic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933040752 2:77462899-77462921 GTGTGTGTAGCGGGGGTGGGGGG + Intronic
933157468 2:78992046-78992068 CTGCGGGCGTCGGGGGCGGGGGG + Intergenic
933608268 2:84407052-84407074 GTGTGTGTGTTGGGGGAGGGGGG - Intergenic
933628878 2:84633828-84633850 TTGTGGGAATCGGAGGAAGGGGG + Intronic
934176789 2:89584306-89584328 CTGGGCGTGGCGGGGGAGGGTGG + Intergenic
934287096 2:91658666-91658688 CTGGGCGTGGCGGGGGAGGGTGG + Intergenic
935332723 2:101988788-101988810 CTCTGGGTCTCGTGGGAGGGGGG + Intergenic
935716742 2:105945925-105945947 GTGTGGGTGTAGGGGGATGGTGG + Intergenic
935977760 2:108595946-108595968 CTGAGGTTATCTGTGGAGGGTGG + Intronic
936032864 2:109086259-109086281 CTGAGGTTGTTGGGGGAGGGGGG + Intergenic
936135375 2:109888475-109888497 CTGAGGTTATCTGTGGAGGGTGG + Intergenic
936209322 2:110483010-110483032 CTGAGGTTATCTGTGGAGGGTGG - Intergenic
936428509 2:112438249-112438271 CTGAGGTTATCTGTGGAGGGTGG - Intergenic
937046525 2:118854880-118854902 CGGTGGGTGTCGGAGGTGGGAGG + Intergenic
938837623 2:135122970-135122992 CTTTGGGAAGCTGGGGAGGGTGG - Intronic
939705092 2:145442599-145442621 TTGTGGGGGTGGGGGGAGGGGGG + Intergenic
939733698 2:145817221-145817243 CTGTGGGGTTGGGGAGAGGGGGG - Intergenic
940809727 2:158228805-158228827 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
942189739 2:173457848-173457870 GAGTGGGAATGGGGGGAGGGCGG - Intergenic
944732321 2:202529336-202529358 ATTTGGGTATGGAGGGAGGGTGG - Intronic
946305581 2:218855354-218855376 AGCTGGGTAGCGGGGGAGGGGGG - Intergenic
946365714 2:219247771-219247793 GGGTGGGTATCTGGGTAGGGAGG + Intronic
946410014 2:219511102-219511124 CTCTGGGTGCAGGGGGAGGGAGG + Intergenic
948005682 2:234605728-234605750 CTGAGGGTAGCGGATGAGGGTGG - Intergenic
1169060529 20:2657549-2657571 CAGTGGGGATGGGGGCAGGGAGG + Intronic
1169064988 20:2690122-2690144 CTGTGGGCACTGGGGTAGGGAGG + Intergenic
1169283085 20:4283879-4283901 CTCTGGGGACTGGGGGAGGGGGG - Intergenic
1169927594 20:10799135-10799157 CTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1170458045 20:16551837-16551859 CTGTAGCTGTCGTGGGAGGGGGG - Intronic
1170907244 20:20527591-20527613 TTGGGGGTGTGGGGGGAGGGCGG - Intronic
1171117810 20:22541430-22541452 CTGTGGGTACCTGGCTAGGGAGG + Intergenic
1172037643 20:32021006-32021028 GGGTGGGTACAGGGGGAGGGTGG - Intronic
1172800960 20:37575926-37575948 CTGAGGGTTTTGGGAGAGGGAGG + Intergenic
1172846631 20:37933516-37933538 CTGTTGGGATCGGGGAGGGGCGG - Intronic
1174084821 20:47999753-47999775 CTGTGGATATCCGTGGGGGGCGG + Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174490352 20:50888872-50888894 TTGTGGGTGTCGGGGGAAGGGGG - Intergenic
1174565756 20:51463362-51463384 CTGTGGGCCTCGGTGGCGGGGGG + Intronic
1174829516 20:53799776-53799798 GTGTGTGTGTTGGGGGAGGGAGG - Intergenic
1175027309 20:55915841-55915863 CTTTGGGTATTTGGGGAGGAAGG + Intergenic
1175177299 20:57119936-57119958 CTGTGGGTACAGGGGTTGGGAGG + Intergenic
1175297962 20:57922156-57922178 ATGTGGGCATCTGGGGAGTGTGG + Intergenic
1175411499 20:58772704-58772726 CTGTTGGGATTTGGGGAGGGTGG + Intergenic
1175913601 20:62415762-62415784 CTGTGGGGACCGGGTGAGGCTGG - Intronic
1176246828 20:64101559-64101581 CTGATGGTATCAGGAGAGGGGGG - Intergenic
1176861731 21:14014791-14014813 CTGTGGGCAGCGGGGGCGGGGGG - Intergenic
1177132985 21:17279800-17279822 CTGGGGGTGTGGGGGGGGGGGGG + Intergenic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1178232356 21:30801058-30801080 CTTTGGGAAGCTGGGGAGGGAGG - Intergenic
1178356423 21:31913478-31913500 GTGTGGGAATAGGGGCAGGGTGG + Intronic
1178534086 21:33398288-33398310 CTGTGGGTATGGCAGGAGTGGGG + Intergenic
1179805200 21:43832852-43832874 CTGTGGGCAACGGGGAAGGCAGG + Intergenic
1181469090 22:23127091-23127113 CTGTGGGGATCTGGGGAATGTGG - Intronic
1182523254 22:30897702-30897724 CCGAAGGTAGCGGGGGAGGGCGG + Intronic
1184663803 22:45977288-45977310 TTGTGTGTCACGGGGGAGGGAGG - Intergenic
1184677397 22:46051148-46051170 CTCTGGGCCTAGGGGGAGGGCGG + Exonic
1184786172 22:46673015-46673037 CTGCGGGGATGGGGGGATGGGGG + Intronic
1185235559 22:49710772-49710794 ATGTGGGTGTCGGGTGAGGCAGG - Intergenic
950442795 3:13019663-13019685 CTGTGGTTAACTGGGGAGGATGG - Intronic
951291200 3:20874060-20874082 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
951668118 3:25149643-25149665 CTGTGGGTATGGGAGGTGAGTGG - Intergenic
952212868 3:31247119-31247141 CTGAGGGTAGCGGAGGAGGAAGG - Intergenic
953071228 3:39521961-39521983 GAGTGGGTATGGGAGGAGGGTGG + Intronic
953941962 3:47107710-47107732 CTTTGGGTGGCGGGGGGGGGTGG + Intronic
953999910 3:47548142-47548164 CTGTGGGAAGCAGAGGAGGGAGG + Intergenic
954690460 3:52392807-52392829 CTGTGGGTGTAGTGGGTGGGGGG - Intronic
955219436 3:57011560-57011582 CTGTGGGTGGCGGGGGAAGGTGG - Intronic
955249379 3:57263388-57263410 GTGTGGGGATGGGGGGTGGGAGG - Intronic
955557074 3:60149782-60149804 CTATGGGTAGGGGGGTAGGGGGG - Intronic
955907696 3:63824935-63824957 CTGTGGGGATCAGGGAAGGGAGG - Intronic
956779953 3:72595967-72595989 CTGTGGGAGTCGAGGGATGGAGG - Intergenic
956787477 3:72654534-72654556 GTGTGTGTGTCGGGGGTGGGGGG - Intergenic
957245122 3:77706659-77706681 CTGTAGGTATCGGGGTATAGAGG + Intergenic
957686334 3:83507062-83507084 CTTTGGGTTTCTGAGGAGGGTGG + Intergenic
960955355 3:123027371-123027393 GGGTGGGTATCGGGGTAGAGAGG - Intronic
961091611 3:124117625-124117647 GTGTGTGTGTCGGGGGAGTGGGG + Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
962318865 3:134374931-134374953 GTGTGTGTACCGGGGGAGGTGGG + Intronic
962880515 3:139572291-139572313 CTGTGCTTATCGGGGATGGGTGG + Intronic
963603755 3:147397408-147397430 CTGTGGGGGTGGGGTGAGGGAGG - Intronic
965102962 3:164326328-164326350 CTGTGGGGAACGGGGGAGGCAGG + Intergenic
965668313 3:171119794-171119816 TTGTGGGGTTGGGGGGAGGGAGG + Intronic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
966568033 3:181404888-181404910 CTTTGGGTGGCGGAGGAGGGTGG + Intergenic
966934208 3:184695183-184695205 CTGGGGGAAGCGGTGGAGGGAGG - Intergenic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
968545506 4:1195711-1195733 CTGGGGGTCTCCGGGGTGGGGGG - Intronic
968887234 4:3341366-3341388 ATGGGGGTACGGGGGGAGGGAGG + Intronic
968887298 4:3341528-3341550 ATGGGGGTGTGGGGGGAGGGAGG + Intronic
969022465 4:4147488-4147510 CTGTGGGCACTGGGGGGGGGGGG - Intergenic
969314132 4:6371388-6371410 CTGTGGGGAGCAGGGGAGGCAGG - Intronic
969468122 4:7369824-7369846 GTGTGAGCATCGGGGTAGGGAGG - Intronic
969832169 4:9806664-9806686 CTGTGTGCATGGGGGGTGGGAGG + Intronic
970143053 4:13003509-13003531 GTGTGTGTGTGGGGGGAGGGGGG + Intergenic
970339763 4:15093676-15093698 CTTTGGGAATCTGGGGAAGGTGG - Intergenic
970558451 4:17259269-17259291 TTGTGGGGGTGGGGGGAGGGGGG - Intergenic
970736048 4:19169121-19169143 GTGGTGGGATCGGGGGAGGGGGG + Intergenic
971537553 4:27772526-27772548 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
973093671 4:46169910-46169932 CTGTGGGGTGAGGGGGAGGGCGG + Intergenic
973781105 4:54288938-54288960 CTGTGGGTCTAGGGGGAGGGAGG + Intronic
974272161 4:59664501-59664523 GTGTGGGTAACGGGGAAAGGAGG - Intergenic
975025365 4:69542221-69542243 CTGTGGGTTTGTGGGGTGGGAGG - Intergenic
976607238 4:86995297-86995319 CCGTGGGGAGAGGGGGAGGGAGG - Intronic
978137609 4:105281508-105281530 GTGAGTGTATTGGGGGAGGGGGG - Intergenic
979195602 4:117916805-117916827 CTGTGGGTGTCAGTGGATGGGGG + Intergenic
979482720 4:121237997-121238019 CTGTGGAAATCGGGAGAGGGAGG - Intergenic
979835318 4:125359798-125359820 CTGTGTGTTTGTGGGGAGGGAGG + Intronic
980419958 4:132546587-132546609 GTGTGGGTGTGGGGGTAGGGCGG - Intergenic
981522773 4:145680973-145680995 TTGTGGGTGTCTGGTGAGGGAGG + Intronic
982612468 4:157593325-157593347 CTGTGGGTAATGGGAGAGGCTGG - Intergenic
982759744 4:159267073-159267095 CAGTGTGTATAGGGAGAGGGAGG + Intronic
982899650 4:160981838-160981860 CTGTGGGCATTGGGGGTGGAGGG + Intergenic
986335847 5:6754818-6754840 CTGTGGGTAGCGGAGGTGTGCGG + Exonic
987192139 5:15489381-15489403 CTGTTGGTATCCAGTGAGGGAGG + Intergenic
987348941 5:17004266-17004288 GTGTGGGTGTTTGGGGAGGGGGG - Intergenic
992970290 5:82049395-82049417 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
993968309 5:94385896-94385918 GTGTGTGTATTGGGGGATGGGGG + Intronic
995907197 5:117139646-117139668 CTGTGGATATGGGAGGAGAGAGG + Intergenic
996000917 5:118362461-118362483 CTGTCGGTGTAGGGGGAGGAGGG + Intergenic
996403607 5:123087266-123087288 CTCTGGGAAGCGGAGGAGGGAGG - Intergenic
997438511 5:133892257-133892279 CTGTGGGTATCTGGGGTGGGGGG + Intergenic
998003136 5:138640132-138640154 CTGTGGGTGGCGGGGTGGGGTGG + Intronic
998093158 5:139382566-139382588 CTGTGGGTAGCGGGGTCGAGGGG + Exonic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
999122298 5:149218784-149218806 CTGTGGGGATGGGGGAAGAGAGG - Intronic
999254935 5:150204922-150204944 CTCTTGGTAACTGGGGAGGGCGG + Exonic
999298791 5:150477469-150477491 GTGTGTGTGTTGGGGGAGGGAGG + Intergenic
999434302 5:151551191-151551213 CTATGGGTATAGGGGGATGATGG - Intronic
999651659 5:153774067-153774089 GTGTGTGTGTGGGGGGAGGGGGG - Intronic
1000796366 5:165670006-165670028 GTGTGTGTGTCGGGGGTGGGGGG - Intergenic
1000917753 5:167102605-167102627 CTGTGTCTCTCTGGGGAGGGTGG + Intergenic
1001091400 5:168744044-168744066 CTCTGGGAATCCGGGGCGGGTGG + Intronic
1001402169 5:171451882-171451904 CTGTGGGGCTCCGGGGTGGGTGG - Intronic
1001756595 5:174175084-174175106 CAGTTGGTATTGGGGGTGGGTGG + Intronic
1002368525 5:178730931-178730953 CTGTGGGAATTTCGGGAGGGAGG + Intergenic
1002427087 5:179182804-179182826 CTGTAGGCGTCTGGGGAGGGTGG + Intronic
1002476601 5:179469838-179469860 GTGATGGTATCGGGGGTGGGAGG - Intergenic
1003421092 6:5959193-5959215 CAGTGGGTGGCGGGGGAGGGGGG + Intergenic
1003428951 6:6021534-6021556 CTGTGTGTATCAGGGGTGTGGGG - Intergenic
1003874440 6:10423625-10423647 GTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1005430407 6:25750776-25750798 TTGTGTGTGTGGGGGGAGGGGGG + Intergenic
1005929656 6:30474467-30474489 CTGTGGGGAGAGGGAGAGGGAGG - Intergenic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1007288412 6:40765263-40765285 CTGAGGGGATCTGGGGAGTGAGG + Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1008284744 6:49634990-49635012 CTGTGTGTGTCGGGGGGGTGGGG + Intronic
1008637399 6:53424552-53424574 CAGTGGTTATCTGGTGAGGGGGG + Intergenic
1008683222 6:53896419-53896441 GTGTGTGTATGGGGGAAGGGAGG + Intronic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010191519 6:73201695-73201717 CTTTGGGAGGCGGGGGAGGGTGG - Intergenic
1010203857 6:73306315-73306337 CTCGGGGTGTCGGGTGAGGGAGG - Intronic
1011394483 6:86891822-86891844 CTGTGGGTTTTGGGGGATAGGGG - Intergenic
1012458699 6:99436154-99436176 CTGGGCCTGTCGGGGGAGGGGGG - Intronic
1012472625 6:99588967-99588989 CTGTGGGACTCCGGGGAGCGAGG + Intergenic
1012521478 6:100126508-100126530 CTGTGACTATCGGGGAGGGGGGG - Intergenic
1013310962 6:108893453-108893475 CTGCAGGGATCGGGGAAGGGAGG + Intronic
1016440930 6:144082621-144082643 AAGTGGGTGTGGGGGGAGGGGGG + Intergenic
1017472786 6:154756781-154756803 CTTTGGGAAGCGGAGGAGGGCGG + Intronic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018731876 6:166657531-166657553 TTGTGGGAACCAGGGGAGGGAGG + Intronic
1018787422 6:167119054-167119076 CAGTGGGGAGCTGGGGAGGGTGG - Intergenic
1019485155 7:1285913-1285935 CAGCGGGGATCTGGGGAGGGAGG - Intergenic
1019705690 7:2496161-2496183 TTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1019760822 7:2811281-2811303 CTCTGGGCATCGGTGGAGCGGGG - Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020123751 7:5520759-5520781 CTGTGGGTGTCTGGGGACAGCGG + Intergenic
1024452208 7:49560245-49560267 TTGTGGGTTGGGGGGGAGGGGGG + Intergenic
1025777015 7:64569000-64569022 ATGGGGGTTTCGGGGGTGGGAGG + Intergenic
1026589295 7:71681518-71681540 CTGTGGGTATCCTAGGAAGGTGG - Intronic
1026656798 7:72263657-72263679 CTGTGGGAGGCGGAGGAGGGAGG - Intronic
1026824696 7:73574115-73574137 CTGTGGCTCTAGGGGAAGGGTGG + Exonic
1026826052 7:73582263-73582285 CTGTGGGCAGTGGGGTAGGGAGG + Intergenic
1027408535 7:77888501-77888523 CTGGAGGCATTGGGGGAGGGAGG + Intronic
1027522675 7:79229939-79229961 CTGTGAGGGTGGGGGGAGGGGGG - Intronic
1028451473 7:90989722-90989744 CTGGGGGTAGTGGGTGAGGGCGG - Intronic
1029646840 7:101862263-101862285 CTGTTGGTCTCGGGGGTGTGTGG + Intronic
1030064433 7:105648600-105648622 CTGTGTGTATGGGAGGTGGGGGG - Intronic
1030303998 7:108001978-108002000 CGGTGGGTTTCCCGGGAGGGAGG - Intronic
1032075411 7:128833597-128833619 CGGTGTGTATATGGGGAGGGTGG - Intronic
1032195601 7:129786494-129786516 GTGTGGGTTGCGGGGGTGGGGGG + Intergenic
1032427419 7:131832948-131832970 CTGTGGGTAGCAGGGCAGTGGGG - Intergenic
1032582556 7:133116867-133116889 CTGTGTGTGTGTGGGGAGGGGGG - Intergenic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1033908409 7:146235255-146235277 TGGTGGGTTTTGGGGGAGGGTGG + Intronic
1034270153 7:149799811-149799833 CTGTGGGTGTAGGTAGAGGGAGG - Intergenic
1034978622 7:155461854-155461876 CTGTGGGAATCAGGGGCAGGTGG - Intronic
1035391690 7:158508592-158508614 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391703 7:158508649-158508671 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391715 7:158508706-158508728 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391727 7:158508763-158508785 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391739 7:158508820-158508842 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391752 7:158508877-158508899 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035546122 8:483596-483618 CTGTGGGCATCTTGTGAGGGGGG + Intergenic
1035652744 8:1281286-1281308 CTGTGAGAAACGGGGGATGGTGG + Intergenic
1035770102 8:2140078-2140100 CTGTGGGTACCAGGGGCTGGGGG - Intronic
1035913046 8:3589597-3589619 GTGTGGGTATCAGGGGCTGGAGG + Intronic
1036753045 8:11455274-11455296 CTGTGTGTGTCTGGGGGGGGTGG + Intronic
1036944984 8:13086778-13086800 CTTTGGGAAGCTGGGGAGGGAGG + Intronic
1037062538 8:14532702-14532724 CTTTGTGTGTGGGGGGAGGGCGG + Intronic
1037338877 8:17820677-17820699 GTGTGTGTAGAGGGGGAGGGAGG - Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1038179010 8:25209086-25209108 CTGAGGGCATCTGGTGAGGGAGG + Intronic
1038692264 8:29774177-29774199 CTGTGGGCATTGGGGGAGGGAGG - Intergenic
1038980325 8:32752329-32752351 CTGTGGCTATGGGGGAGGGGAGG + Intronic
1041064841 8:54072733-54072755 CTTTGGGTAGCGGAGGCGGGCGG + Intronic
1041117561 8:54554670-54554692 CTGTGGTTGCCGAGGGAGGGAGG + Intergenic
1041618316 8:59934358-59934380 CTGTGGATATCTGGGGAAGAGGG + Intergenic
1042179110 8:66067180-66067202 CGGTGGGAAGTGGGGGAGGGTGG - Intronic
1043961774 8:86424815-86424837 CTGTGGGGAGAGGGAGAGGGAGG + Intronic
1045154995 8:99458061-99458083 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1045224830 8:100234421-100234443 CTGAGGGTAGGGGTGGAGGGAGG - Intronic
1045538611 8:103059666-103059688 CAGTGGGTCTTGGGGGAGTGGGG - Intronic
1045582762 8:103499301-103499323 GTGGGGATAGCGGGGGAGGGAGG - Intergenic
1047198108 8:122740115-122740137 CTGGGGGTGGTGGGGGAGGGAGG - Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047634400 8:126744480-126744502 CTGTGGGTGTCAGGGGATGGAGG + Intergenic
1047742391 8:127817012-127817034 CTGTTTGTATCGGGAGGGGGTGG - Intergenic
1048389506 8:133948152-133948174 CTGTGTGTATGGGGTGGGGGTGG + Intergenic
1048695800 8:137026389-137026411 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1049254006 8:141604510-141604532 CAGTGGCTCTCGGGGAAGGGGGG - Intergenic
1049373167 8:142277301-142277323 CTGCGAGTGTCTGGGGAGGGCGG - Intronic
1049707763 8:144050772-144050794 CTGGGGGATCCGGGGGAGGGCGG - Intergenic
1050259854 9:3829438-3829460 CTCTGGGAATCGGGGTAGTGTGG + Exonic
1051157525 9:14167073-14167095 GTGTGTGTGTCGGGGGGGGGGGG + Intronic
1051330856 9:16023834-16023856 TTGTGGGGGTGGGGGGAGGGTGG - Intronic
1052462607 9:28785630-28785652 CCCTGGGTGGCGGGGGAGGGAGG - Intergenic
1052791212 9:32877031-32877053 CTTTGGGTTTCGGGGTGGGGTGG + Intergenic
1052840751 9:33289474-33289496 GTGTGGGTCTGGGGGGTGGGGGG + Intergenic
1053008995 9:34622902-34622924 CTTTGGGAAGCGGAGGAGGGCGG + Intronic
1055774617 9:79753909-79753931 GTGTGGGTATGGGGTGAGGTCGG + Intergenic
1056268706 9:84925350-84925372 CTGTGGGAAACGGGAGGGGGCGG - Intronic
1057057384 9:91974172-91974194 CTGTTGGAAGCTGGGGAGGGAGG + Intergenic
1057665116 9:97038917-97038939 AGGTGGGGAACGGGGGAGGGCGG - Intronic
1058099734 9:100905686-100905708 CTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1058187429 9:101871419-101871441 CTGTGGGAGTCGGGGGTGGTGGG - Intergenic
1058198084 9:102003352-102003374 CAGTGTGTGTTGGGGGAGGGTGG - Intergenic
1058275649 9:103038190-103038212 CTGTGGGTGTTGGGGGACAGGGG - Intergenic
1058612909 9:106794209-106794231 CAGGGGGGATCGGGGGCGGGGGG + Intergenic
1058663255 9:107284441-107284463 TTTGGGGCATCGGGGGAGGGTGG - Intronic
1058857375 9:109076377-109076399 CTGTGGGGTGGGGGGGAGGGGGG + Intronic
1059071269 9:111139018-111139040 CCCTGGGTATCCGGGGTGGGGGG - Intergenic
1060439575 9:123626345-123626367 CTGTGTGTCTGGGGGGAGAGGGG + Intronic
1060592826 9:124829921-124829943 CTGCTGGGGTCGGGGGAGGGAGG - Intergenic
1060937938 9:127526812-127526834 CTGTGGCTGTCGAGGGTGGGAGG + Intronic
1061498363 9:130988840-130988862 GTGTGTGTGTTGGGGGAGGGGGG - Intergenic
1062103208 9:134738989-134739011 CTGTGGCTATGGGGAGAGTGGGG + Intronic
1062343296 9:136103385-136103407 CTGGGGGTCTCGAGGGACGGAGG - Intergenic
1186559482 X:10595658-10595680 CTGAGGGTATGGGGGAAGGGAGG + Intronic
1186912367 X:14182314-14182336 CTGTGGATAGTGGAGGAGGGAGG - Intergenic
1188097202 X:26039280-26039302 CTGTTGGTGTCTGGGGAGAGTGG - Intergenic
1188862212 X:35271336-35271358 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1189408346 X:40746399-40746421 CTGAGGGTAAAAGGGGAGGGAGG + Intergenic
1190331055 X:49235702-49235724 ATGTGGGCTTCGGGGGTGGGCGG - Intronic
1191067920 X:56369961-56369983 TTGTGGGGTGCGGGGGAGGGGGG - Intergenic
1191103447 X:56757890-56757912 GTGTGGGTATTGGAGGAGGGTGG + Intergenic
1191165645 X:57387865-57387887 ATGTGTGTATCTGAGGAGGGAGG + Intronic
1192639744 X:72850445-72850467 GTGTGTGTATGGGGGGAGGGGGG - Intergenic
1192641967 X:72870360-72870382 GTGTGTGTATGGGGGGAGGGGGG + Intergenic
1193986410 X:88246172-88246194 CAGTGGGTCTAGTGGGAGGGTGG - Intergenic
1194110270 X:89824827-89824849 CTGTGGGCATGTGGGGATGGAGG + Intergenic
1195272226 X:103243103-103243125 CTGTGTGTATGGTGGGAGTGTGG - Intergenic
1195792822 X:108607482-108607504 CTTGGGGTATGGGGGGAGGGTGG - Intronic
1195828916 X:109033567-109033589 TTGTGGGTATGGGGGATGGGTGG + Intergenic
1195937450 X:110139313-110139335 CTGTGGGGATGGGTGCAGGGAGG + Intronic
1196440336 X:115714187-115714209 CTGTGGCTATCTGGGGATGGGGG - Intergenic
1196644605 X:118103728-118103750 CTGTGTGTGTTGGGGGAGGCAGG - Intronic
1199077034 X:143536117-143536139 CTGTGGGTGTCAGGGGAAGGGGG - Intergenic
1199473400 X:148220038-148220060 CTTTGGGAATGGGGGTAGGGAGG - Intergenic
1199680804 X:150223384-150223406 CTGGGGCTATGGGGGCAGGGAGG - Intergenic
1200035016 X:153321309-153321331 CTCTGGCTTTCGGGGGAGGAAGG - Intergenic
1200064755 X:153498963-153498985 CTGTGTGCATTGGGAGAGGGTGG + Intronic
1200119114 X:153782066-153782088 CTGTGGGCTTCAGGGCAGGGTGG + Intronic
1200462931 Y:3479568-3479590 CTGTGGGCATGTGGGGATGGAGG + Intergenic
1201387881 Y:13463010-13463032 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1201572736 Y:15431905-15431927 TTGTGGGAGTTGGGGGAGGGGGG + Intergenic
1201688940 Y:16741047-16741069 CAGAAGGGATCGGGGGAGGGAGG - Intergenic
1202348136 Y:23957017-23957039 GTGGTGGTGTCGGGGGAGGGGGG - Intergenic
1202522638 Y:25713087-25713109 GTGGTGGTGTCGGGGGAGGGGGG + Intergenic