ID: 1177179211

View in Genome Browser
Species Human (GRCh38)
Location 21:17726684-17726706
Sequence GTTTTGAAGGGGAATCTGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177179205_1177179211 5 Left 1177179205 21:17726656-17726678 CCCAGTGCCTGGGGGAATGAGCG No data
Right 1177179211 21:17726684-17726706 GTTTTGAAGGGGAATCTGTACGG No data
1177179203_1177179211 13 Left 1177179203 21:17726648-17726670 CCAACACTCCCAGTGCCTGGGGG No data
Right 1177179211 21:17726684-17726706 GTTTTGAAGGGGAATCTGTACGG No data
1177179199_1177179211 16 Left 1177179199 21:17726645-17726667 CCACCAACACTCCCAGTGCCTGG No data
Right 1177179211 21:17726684-17726706 GTTTTGAAGGGGAATCTGTACGG No data
1177179198_1177179211 23 Left 1177179198 21:17726638-17726660 CCATCAGCCACCAACACTCCCAG No data
Right 1177179211 21:17726684-17726706 GTTTTGAAGGGGAATCTGTACGG No data
1177179206_1177179211 4 Left 1177179206 21:17726657-17726679 CCAGTGCCTGGGGGAATGAGCGT No data
Right 1177179211 21:17726684-17726706 GTTTTGAAGGGGAATCTGTACGG No data
1177179207_1177179211 -2 Left 1177179207 21:17726663-17726685 CCTGGGGGAATGAGCGTCTCAGT No data
Right 1177179211 21:17726684-17726706 GTTTTGAAGGGGAATCTGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177179211 Original CRISPR GTTTTGAAGGGGAATCTGTA CGG Intergenic
No off target data available for this crispr