ID: 1177185758

View in Genome Browser
Species Human (GRCh38)
Location 21:17794207-17794229
Sequence ATCCTTGATCTGCTACTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177185758 Original CRISPR ATCCTTGATCTGCTACTGAT TGG Intronic
901518813 1:9768087-9768109 ATCGTAGCTCTGCTACTTATTGG - Intronic
903141014 1:21339174-21339196 GTTCTAGTTCTGCTACTGATTGG + Intronic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
908816717 1:68042724-68042746 ATCCTGGCTCTGCTACTTACCGG + Intergenic
908916956 1:69139247-69139269 AGCCTAGATCTGCCACTGAAGGG - Intergenic
910213517 1:84818029-84818051 ATCCTGGCTCTTCCACTGATCGG + Intronic
911629074 1:100162007-100162029 AACCTTGATATGCCACTGGTGGG - Intronic
914469016 1:147957277-147957299 ATCCTTGATCTACAACTTAATGG + Intronic
915701400 1:157800303-157800325 GTCCTAGATCTGGTACTAATTGG - Intronic
919094224 1:193010466-193010488 ATCCTAGATCTACTACTTACTGG + Intergenic
919225993 1:194702294-194702316 ATACTTGAGCTGCTACTGGAAGG - Intergenic
920113827 1:203605606-203605628 ATCCTGGCCCTGCCACTGATGGG + Intergenic
920694026 1:208168051-208168073 ATCCTGGTTTTGCTACTCATGGG + Intronic
921639823 1:217539552-217539574 ATCATAGGTCTGCTACTGAGGGG - Intronic
922967121 1:229699605-229699627 ATCCTTGCTTTGCTACTTACTGG + Intergenic
924431380 1:243999986-244000008 GTCTTTGATCTCCTACTAATTGG - Intergenic
1063697018 10:8346424-8346446 ATCATTGACCTGCTTTTGATTGG - Intergenic
1067091497 10:43267819-43267841 AGCCTTGCTCTGCCACTTATAGG - Intergenic
1068718187 10:60211419-60211441 ATCCTTGTTCTGCCACTAATTGG + Intronic
1069207941 10:65716368-65716390 ATTCTGGATCTGCCAGTGATAGG - Intergenic
1072470017 10:95705143-95705165 ATATTTCATTTGCTACTGATAGG + Intergenic
1072941097 10:99764703-99764725 AACCTTCATATGCCACTGATGGG + Intergenic
1073565972 10:104535998-104536020 ATCCTTGCTCTGTTACTTCTAGG + Intergenic
1073979197 10:109135011-109135033 TTCCTTCTTTTGCTACTGATTGG - Intergenic
1074164510 10:110863240-110863262 ATCCTAGTTGTGCTACTAATTGG - Intergenic
1075911045 10:126126131-126126153 ATCTTGGCTCTGCTGCTGATTGG - Intronic
1077764039 11:5137715-5137737 ATCCTAGACCTGCTATTGCTTGG + Intergenic
1078873731 11:15373165-15373187 ATCCTAATTCTGCCACTGATTGG - Intergenic
1079979284 11:27132093-27132115 ATTCTTGGTCTGCAACTGAAAGG - Intergenic
1081912905 11:46711579-46711601 GTCCTGGTTCTGCTACTGACTGG - Intergenic
1083922715 11:65789114-65789136 ACACATGATCTGTTACTGATTGG - Intronic
1089283910 11:117393608-117393630 ATCCTAGCTCTTCTACTTATTGG - Intronic
1089488126 11:118862961-118862983 ATCCCAGTTCTGCTACTTATTGG + Intergenic
1090788883 11:130072443-130072465 AACCTTGGTGTGCTTCTGATAGG + Intronic
1100472866 12:94909174-94909196 ATCCTTTATCAGCACCTGATGGG + Intronic
1102073188 12:110038689-110038711 AACCTTGTATTGCTACTGATGGG - Exonic
1103331085 12:120154523-120154545 ATCCTCCAACTGCTACTCATGGG + Intronic
1103485309 12:121278963-121278985 ATCCTAGAGCTGCCTCTGATAGG + Intronic
1106178818 13:27353641-27353663 ATCCCTGCTCTGCTAATCATTGG - Intergenic
1108094894 13:46891305-46891327 ATCCTTGTTGTGCTACTTACTGG + Intronic
1108960123 13:56216556-56216578 GTCCTTGATCTGCTCTTCATGGG - Intergenic
1109061579 13:57628946-57628968 ATCTTAGATCTCCTAATGATTGG + Intergenic
1112624986 13:101093826-101093848 GTCCTTGAGCTGCTAAGGATGGG - Intronic
1115451805 14:33556690-33556712 ATCCTGGCTCTGCCACTGACTGG + Intronic
1116405646 14:44562621-44562643 ATCCCTGCTCTGCTACACATAGG - Intergenic
1122918099 14:104868042-104868064 ACCCATGAGCTGCTCCTGATGGG + Intronic
1125098826 15:35886293-35886315 ATCTTGGTTCTGCTACTGACTGG + Intergenic
1128353267 15:66906212-66906234 ATCCTTCCTCTGCTACTTACTGG + Intergenic
1128648723 15:69395354-69395376 ATCCTAGCTCTGCTTCTTATTGG + Intronic
1129484867 15:75860997-75861019 ATCTTTGTTCTGCTACTTACTGG + Intronic
1130428826 15:83826015-83826037 ATACTTGACCTTCTACTGTTTGG - Intronic
1135037231 16:19088378-19088400 ATCCTAAATCTGCTTCTGCTTGG + Intergenic
1135185828 16:20314993-20315015 ATCCCAGCTCTGCTACTGACTGG - Intronic
1140379054 16:74470059-74470081 ATCCTTCATCTGCACCTGAAAGG + Exonic
1144085302 17:11802937-11802959 ATCCTTGTTCTGCCACAAATTGG + Intronic
1149606388 17:57927950-57927972 ATCCTTCCTCTGCTACTTGTGGG - Intronic
1155674372 18:28411651-28411673 ATGCTAAATCTGCTACTTATTGG - Intergenic
1156460247 18:37317716-37317738 CTCCCTGAACTGCTCCTGATAGG + Intronic
1156567111 18:38204307-38204329 AACCTTCATATGCTACTGATTGG - Intergenic
1160609521 18:80074419-80074441 AGCCTGGAGCTGCTGCTGATGGG + Intronic
925586366 2:5468645-5468667 ATACTTGGTTTCCTACTGATTGG + Intergenic
926754478 2:16224258-16224280 ATTCTTGATGTGCCACTGAATGG - Intergenic
927493736 2:23538132-23538154 ATCCTAGTTCTGCTACTTATTGG - Intronic
928439535 2:31280452-31280474 ATCCTAGATCTGCCATTTATTGG - Intergenic
934140594 2:89043602-89043624 GTACTTTATCTGCTACTGATAGG + Intergenic
934228643 2:90156940-90156962 GTACTTTATCTGCTACTGATAGG - Intergenic
936824485 2:116564432-116564454 TGCCTTGATCTCCTAGTGATAGG + Intergenic
939360342 2:141163492-141163514 AATCTTGGTCTGGTACTGATAGG + Intronic
942015946 2:171815485-171815507 CTCATTTATCTGCTACTGTTGGG + Intronic
943628114 2:190221517-190221539 AACCTGGCTCTGATACTGATAGG + Intronic
944529529 2:200653550-200653572 ATCCTTGTTCTGCCATTTATTGG - Intronic
946459851 2:219858924-219858946 ATGCTTTATTGGCTACTGATTGG + Intergenic
946649844 2:221880317-221880339 ATCCTGGCTCTGCTACTCACTGG + Intergenic
947459977 2:230295597-230295619 ATCCTGGATCTGCCACTTAAGGG - Intronic
1169485866 20:6032034-6032056 ATCCTTGCTATGCCACTGCTAGG + Exonic
1171381722 20:24738534-24738556 ATGCTTGATTTCCCACTGATGGG - Intergenic
1172995181 20:39065037-39065059 ATCCTGGATTTGCTACTCACTGG + Intergenic
1174570309 20:51496714-51496736 ATCCTGGTTCTGCCACTTATTGG - Intronic
1175954369 20:62600966-62600988 ATCCTTGATTTGCTTATGAAGGG + Intergenic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1182064045 22:27417812-27417834 AGCCCTGAACTGCAACTGATGGG + Intergenic
1183332688 22:37229861-37229883 GTCCTGGCTCTGATACTGATTGG - Intronic
1183737674 22:39652943-39652965 ATCCTGGTTCTGCTATTGACTGG + Intronic
1183838073 22:40473531-40473553 AAGCTTGATCTGCTAATAATTGG + Intronic
949629057 3:5902407-5902429 ATTCTTTATCTGCATCTGATAGG - Intergenic
950217644 3:11170624-11170646 ATCCTGGCTCTGCCACTGACCGG - Intronic
950632078 3:14288834-14288856 AGCCTTAATCAGCTAATGATGGG - Intergenic
950999997 3:17547034-17547056 CACCTAGATCTGCTACTGATTGG - Intronic
952384916 3:32833446-32833468 GTCCTTAATCTGCTTCTGACTGG + Intronic
953256893 3:41299312-41299334 ATCCTTGGTCAGCTGCTAATGGG - Intronic
955280185 3:57587498-57587520 TTCCTTGCTCCTCTACTGATAGG + Intronic
959555264 3:107710065-107710087 ATCCTTCATGTTCTTCTGATGGG + Intronic
960286206 3:115831784-115831806 ATCCTTGATCTGTTTCTGATAGG - Intronic
960329673 3:116343354-116343376 ACCCTAGATCTGCCACTGACTGG + Intronic
961569892 3:127790114-127790136 ATCCTGGATCTGCCCCTGACTGG + Intronic
962889876 3:139662285-139662307 ATCCTGGTTCTGTCACTGATGGG + Intronic
966297151 3:178437730-178437752 TTCCTTTTTCTGCAACTGATTGG - Intronic
966319129 3:178680959-178680981 CTCCTGGAGCTTCTACTGATTGG - Intronic
966440899 3:179942917-179942939 ATTCTGGCTCTGCTACTTATGGG + Intronic
969177830 4:5412685-5412707 ATCCTTCAAGTGCTACTGAGAGG - Intronic
970538435 4:17053651-17053673 ATCATGCCTCTGCTACTGATTGG - Intergenic
971090239 4:23334802-23334824 AACATTTATATGCTACTGATAGG + Intergenic
972156923 4:36174789-36174811 ATTCTTGTTCTGCTACTAATTGG - Intronic
972731356 4:41798455-41798477 ATCTTTTGTCTTCTACTGATGGG - Intergenic
976701423 4:87973163-87973185 ATTCTTGATTGGCTAATGATTGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978246746 4:106581360-106581382 ATCTTTGATCTAATGCTGATGGG + Intergenic
981041557 4:140227640-140227662 ATCCTTGTTCTGCAACTTACTGG + Intergenic
981062780 4:140444434-140444456 ATCATTTAGCTGCTACTTATAGG + Intronic
984193041 4:176627077-176627099 ATCCTAGATCTGCCTCTTATTGG + Intergenic
989163439 5:38412804-38412826 ACCTTTGATGTGCTACTGAGTGG + Intronic
990715153 5:58628517-58628539 TTCCATGATGAGCTACTGATTGG - Intronic
993566504 5:89482777-89482799 ATACTTGAGCTCCTGCTGATGGG - Intergenic
994149345 5:96431061-96431083 TTCCTTGAGCAGCTACTGAAAGG - Intronic
994746414 5:103683895-103683917 AACTTTTATATGCTACTGATAGG - Intergenic
995273494 5:110250535-110250557 ATCCTTTCTCTGCTGCTGAGTGG - Intergenic
997647598 5:135491455-135491477 ATCCTGGCTCTGCCACTGTTTGG - Intergenic
998449909 5:142226181-142226203 GCCCTTGGTCTGCTACTGTTTGG + Intergenic
1004064839 6:12233843-12233865 CTCCTTGAACTGCTGCTCATGGG + Intergenic
1004316314 6:14591212-14591234 ATCCTGCCTCTGCTACTTATTGG + Intergenic
1005950495 6:30627654-30627676 ATCCTTGATGCACTAGTGATAGG - Exonic
1006512397 6:34528780-34528802 ACCCATGATCTGCTTGTGATAGG - Exonic
1012298906 6:97559774-97559796 ATCCTTGCTCTGCCACTGTTTGG + Intergenic
1014745586 6:125196847-125196869 ATGCTGGATCTGCAACTAATTGG - Intronic
1014943986 6:127475575-127475597 GTCCTTCATCTGCTGCCGATCGG + Exonic
1017058713 6:150460706-150460728 GTCCTGGCTCTGCTACTTATGGG - Intergenic
1017698310 6:157041696-157041718 ATCCCAGTTCTGTTACTGATTGG - Intronic
1025749077 7:64275674-64275696 ATCCTGGTTCTGCCACTTATGGG + Intergenic
1026291314 7:69008705-69008727 ATCTTGGTTCTGCCACTGATAGG + Intergenic
1031159159 7:118145158-118145180 ATCCTGGCTCCTCTACTGATTGG - Intergenic
1034948768 7:155282463-155282485 ATCATTGCTCTGCTGCTGAATGG - Intergenic
1036173893 8:6517713-6517735 ATCATTGTTCTGTTACAGATGGG + Intronic
1039104484 8:33975295-33975317 ATCTTTGCTCTGCAACTAATTGG - Intergenic
1040994817 8:53390921-53390943 AACCTTGCTTTGCTTCTGATAGG + Intergenic
1044478302 8:92654657-92654679 ATCCTTTATCTGCTGCAGTTGGG - Intergenic
1044493310 8:92846664-92846686 ATCCTGGATCTGTTACTGCAAGG + Intergenic
1053609103 9:39692922-39692944 ATCCAGGATCTGCTACTCACTGG + Intergenic
1053866947 9:42449192-42449214 ATCCAGGATCTGCTACTCACTGG + Intergenic
1054089213 9:60778567-60778589 ATCCAGGATCTGCTACTCACTGG - Intergenic
1054244422 9:62649476-62649498 ATCCAGGATCTGCTACTCACTGG - Intergenic
1054558549 9:66684019-66684041 ATCCAGGATCTGCTACTCACTGG - Intergenic
1056648816 9:88440118-88440140 ATCCTTGATATGCTAAGGAAGGG - Intronic
1056648830 9:88440281-88440303 ATCCTTGATATGCTAAGGAAGGG - Intronic
1058663266 9:107284459-107284481 CCCCTTGAACTGCTACTGTTTGG - Intronic
1059400256 9:114065124-114065146 ATCCTTCCTCTGCTTCTGTTTGG - Intronic
1059691660 9:116690702-116690724 ATCCTTGCTCTATTACTTATTGG + Intronic
1059719084 9:116941947-116941969 ATCCTGGCTTTGCTACTGAAAGG + Intronic
1059739219 9:117133372-117133394 ATCCTAGCTCTGCCACTGACTGG - Intronic
1059958928 9:119546330-119546352 ATCCCAGATCTGCTCCTGTTAGG - Intergenic
1061487824 9:130929208-130929230 AGCCTCGATTTGCTCCTGATGGG + Intronic
1188585753 X:31772701-31772723 ATCCTTGTTCTGCTACTTACTGG + Intronic
1190437454 X:50439733-50439755 ATCTTTGATCTGTTACTCATGGG - Intronic
1192307640 X:69979504-69979526 AACCCTTATCTGCTACTGGTGGG - Intronic
1192537378 X:71939634-71939656 ATTCCAGATCTGCCACTGATTGG + Intergenic
1193382377 X:80830283-80830305 AACCTTCATATGCTACCGATAGG + Intergenic
1193851275 X:86540174-86540196 ATCATTCTTCTGCTACTGAGTGG + Intronic
1193912822 X:87327100-87327122 TCCCTTGACCTGCTACTCATGGG + Intergenic
1194079535 X:89442720-89442742 TTCCTTGATCTCCTACTCTTAGG + Intergenic
1194736293 X:97515862-97515884 TCCCTTGTTTTGCTACTGATGGG - Intronic
1195806861 X:108783011-108783033 TTCCTTGATCTACTAATTATTGG + Intergenic
1197087376 X:122494838-122494860 ATTTTTGATGTGCTCCTGATTGG + Intergenic
1200432155 Y:3098026-3098048 TTCCTTGATCTCCTACTCTTAGG + Intergenic