ID: 1177186170

View in Genome Browser
Species Human (GRCh38)
Location 21:17799901-17799923
Sequence TTGCTAGGAGGGACCTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177186170_1177186177 16 Left 1177186170 21:17799901-17799923 CCTTGCAAGGTCCCTCCTAGCAA 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1177186177 21:17799940-17799962 AGTTCTGCCAGGCTACTCAGCGG 0: 1
1: 0
2: 0
3: 6
4: 119
1177186170_1177186178 17 Left 1177186170 21:17799901-17799923 CCTTGCAAGGTCCCTCCTAGCAA 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1177186178 21:17799941-17799963 GTTCTGCCAGGCTACTCAGCGGG 0: 1
1: 0
2: 0
3: 7
4: 121
1177186170_1177186180 27 Left 1177186170 21:17799901-17799923 CCTTGCAAGGTCCCTCCTAGCAA 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1177186180 21:17799951-17799973 GCTACTCAGCGGGTAATTAAAGG 0: 1
1: 0
2: 0
3: 1
4: 56
1177186170_1177186176 5 Left 1177186170 21:17799901-17799923 CCTTGCAAGGTCCCTCCTAGCAA 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1177186176 21:17799929-17799951 CTAGAATTTGCAGTTCTGCCAGG 0: 1
1: 0
2: 2
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177186170 Original CRISPR TTGCTAGGAGGGACCTTGCA AGG (reversed) Intronic
900646462 1:3711011-3711033 TTGGTGAGAGGGACCCTGCATGG + Intronic
902081666 1:13825154-13825176 TTGCTGGGAGGGAGCATTCAGGG - Intergenic
903210658 1:21816301-21816323 TTGCTAAATGGGACCTGGCATGG + Intronic
904926533 1:34053417-34053439 TTGCTAGGAGGGACCCAAGAAGG - Intronic
908172422 1:61519045-61519067 TTGCTAGGAGTGAAATTGCTGGG + Intergenic
911231620 1:95367882-95367904 TTGTTAGGAGAGTCCTTGCGGGG - Intergenic
916927905 1:169542301-169542323 TCACTAGGAGGGTCCTTCCAGGG + Exonic
917504145 1:175613115-175613137 TTGCCAGGAGAGACTTTGCAGGG + Intronic
923846351 1:237736948-237736970 TTGCTAGGAGGTGGCTTGTAAGG + Intronic
1063304405 10:4883710-4883732 TGGCTGGGAGGGACTTTACATGG - Intergenic
1064716413 10:18181239-18181261 TTGCTAAGAGGGAAGTTTCATGG - Intronic
1068527564 10:58147825-58147847 TTCCTAGTGGGGACTTTGCATGG + Intergenic
1069571320 10:69495990-69496012 TTGCTACAAGCAACCTTGCAGGG + Intronic
1070987065 10:80698218-80698240 ATCCAAGCAGGGACCTTGCAGGG + Intergenic
1072221522 10:93331411-93331433 TTGCTCGGAGGCACCCTGGAAGG - Intronic
1074498093 10:113997445-113997467 TTGCGAGGAAGGTCGTTGCAGGG + Intergenic
1077777294 11:5285597-5285619 ATGCTAGGAGGGCCTCTGCATGG + Intronic
1078873813 11:15373905-15373927 TTGCTGTGAGTGACCTTGCGTGG - Intergenic
1084736699 11:71109910-71109932 TTGCTAGAGGGGACCTTACCAGG - Intronic
1088784645 11:113170154-113170176 TTGCTAGGATTGTCCTTTCATGG + Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1091614468 12:2038810-2038832 TTGCTAGGAAGTGACTTGCATGG - Intronic
1092663965 12:10773293-10773315 ATGCAAGGTGGGATCTTGCATGG + Intergenic
1095578781 12:43770818-43770840 TTGATAGGTGGGACCTTTAAAGG + Intronic
1095891474 12:47238629-47238651 CTCTTAGGAGGGAACTTGCAAGG - Intergenic
1096630861 12:52925991-52926013 CTGCTAGGAGGGAGCTTGAAAGG - Intronic
1099589928 12:84574567-84574589 TTTCTAGTAGGGACCTGGAAAGG - Intergenic
1100788704 12:98106958-98106980 TTCCTAGGTCTGACCTTGCAGGG + Intergenic
1104326931 12:127808025-127808047 GTGAGAGGAGGGACCTTGCGAGG - Intergenic
1107530692 13:41279730-41279752 TTCCCATGAGAGACCTTGCAGGG - Intergenic
1110390394 13:74966996-74967018 TTGCTAGGAAGCAACTTGCTCGG - Intergenic
1115623445 14:35164969-35164991 TTGTTTGCAGGTACCTTGCAGGG + Intronic
1118471479 14:66078877-66078899 TAGCTAGGAGTGAACTTGCTGGG + Intergenic
1118697201 14:68396850-68396872 TTTCTAGGAGGGAAAATGCATGG - Intronic
1118769144 14:68929906-68929928 TTGCAAAGAGGGACCTGGCCAGG + Intronic
1119013997 14:71030515-71030537 TTGCACGGAGGCACCTTCCAAGG + Intronic
1126114476 15:45196516-45196538 ATGCTAGGAAGGACCTAGGATGG - Intronic
1128429594 15:67578272-67578294 GTGCTAAGAGGTACCATGCATGG + Intronic
1128700576 15:69801305-69801327 TTCCTTGGAAGGACCATGCAAGG + Intergenic
1129320108 15:74770008-74770030 GTGCCAGGAGGGACCTGGCATGG - Intergenic
1130862753 15:87905751-87905773 TTGGAAGGAGGGACCATGCATGG - Intronic
1131855643 15:96590802-96590824 TTGCTAGGGGGTACATCGCATGG + Intergenic
1133555328 16:6901339-6901361 TTGCTAGGTGGGACATTTCCAGG - Intronic
1139673092 16:68505029-68505051 TTGCCAGGTGTGCCCTTGCAGGG + Intergenic
1140022437 16:71251278-71251300 CTGCTACCAGGGACCTTGCGGGG + Intergenic
1140477030 16:75244173-75244195 CTCTGAGGAGGGACCTTGCAGGG - Intronic
1140815867 16:78620328-78620350 TTGATAGGAGGCACAATGCAGGG - Intronic
1148203618 17:45765996-45766018 CAGCTAGGAGGGACCCTGCAGGG + Intergenic
1153386916 18:4509243-4509265 CTCCTAGGAGTCACCTTGCATGG - Intergenic
1153962154 18:10149012-10149034 CTGCCAGGAGGCACCCTGCAAGG + Intergenic
1158613060 18:58960849-58960871 AAGCTAGGAGGGATTTTGCAAGG + Intronic
1160255867 18:77248846-77248868 TTGCTAGGGAGTTCCTTGCAAGG - Intergenic
1161078062 19:2296084-2296106 GTGCTGGGAGGGAGCTTGCTGGG - Intronic
1164270985 19:23671501-23671523 TTGACAGCAGGGACCTGGCAGGG - Intronic
925701428 2:6642374-6642396 TTGATAAGAGGGAGCTAGCATGG + Intergenic
927269076 2:21186642-21186664 TGGCTAGGAGGCACACTGCAAGG - Intergenic
929246799 2:39711033-39711055 TCTCTGGGAGGGCCCTTGCATGG - Intronic
929655297 2:43725082-43725104 TAGCGAGGAGGGAGCTTGTAAGG + Intronic
930355227 2:50309728-50309750 TTCCTAGGAGGCAGCTGGCAAGG - Intronic
932323360 2:70838051-70838073 CTGGTAGAAGGGGCCTTGCAGGG + Intergenic
935181246 2:100692946-100692968 TTCCTAAGAGGGAGCTTGCAGGG - Intergenic
936418650 2:112343573-112343595 TTGCTTGGAGAGTGCTTGCAGGG - Intergenic
938763519 2:134445358-134445380 TTGCCAGGTGGGACCTGGCAAGG + Intronic
942312970 2:174672659-174672681 TTGTTAGGATGGACCTTACGTGG + Intronic
944827689 2:203502142-203502164 TAGCTACCAGGGAACTTGCATGG + Intronic
946035124 2:216735903-216735925 TAGCCAGGAGGGACCATACAGGG + Intergenic
946211738 2:218152932-218152954 GTGGGAGGAGGGACCTTGGAAGG - Intergenic
948288741 2:236808476-236808498 TGGCTAGGAGGCACTGTGCAGGG - Intergenic
948398509 2:237664806-237664828 TTGCTAGAAGGGAAATTGCTGGG + Intronic
1168796944 20:616932-616954 TGGCTTGGAGGGACCCTGGAGGG - Intergenic
1169480169 20:5972813-5972835 TTACTAAGAGCTACCTTGCAAGG - Intronic
1169908919 20:10631173-10631195 CTGCTAGGAGTGCCCTTGCATGG - Intronic
1170199541 20:13727987-13728009 TTGCTGAGAGGGACCTAGAATGG + Intronic
1171137294 20:22708254-22708276 TTGCCAGGAGTGGACTTGCAGGG + Intergenic
1171905085 20:30893817-30893839 ATGAAAGGAGGGACCTTGGAAGG - Intergenic
1172594577 20:36141582-36141604 ATTCTAGGAGGGACCTTCAATGG + Intronic
1177186170 21:17799901-17799923 TTGCTAGGAGGGACCTTGCAAGG - Intronic
1180338512 22:11599997-11600019 ATGAAAGGAGGGACCTTGGAAGG - Intergenic
1181968786 22:26674682-26674704 CTGCTGGCAGGGACCTTGGATGG + Intergenic
958679359 3:97306548-97306570 TCACTGGGAGGGACCCTGCAAGG - Intronic
959000985 3:100964128-100964150 CTGCAAGGTGGGATCTTGCAAGG + Intronic
959869714 3:111312586-111312608 TTTCTAGGAGGAACTTTGGAAGG - Intronic
965284752 3:166804955-166804977 GTGCTAGGAAGTACCTTACAGGG - Intergenic
965409209 3:168308542-168308564 TTCCTAGCAGGGTCCGTGCATGG + Intergenic
968962756 4:3753614-3753636 TCGCCAGGAGGGACCTTCCAGGG - Intergenic
970669056 4:18375162-18375184 TTGCCAGTAGGGACTCTGCAGGG - Intergenic
974507589 4:62796955-62796977 TAGGGAGGAGGGACCCTGCATGG - Intergenic
975497546 4:75051540-75051562 TAGCTGAGAGGGACTTTGCAAGG - Intergenic
979648067 4:123094982-123095004 TTTGTATGAGGGACCTTGCATGG - Intronic
985958733 5:3283738-3283760 ATGCTAGGATGCACCTGGCAAGG - Intergenic
986604256 5:9505767-9505789 CTGCTAGGAGGTATCGTGCAGGG + Intronic
986755039 5:10827490-10827512 AAACTAGGAGGGAGCTTGCAGGG - Intergenic
988225606 5:28408050-28408072 GTCCTAGGAGAGACCTTGGAAGG + Intergenic
995906426 5:117129321-117129343 TTGCAAGTAGGGATTTTGCAGGG - Intergenic
999086627 5:148897870-148897892 TGGCTAGGAGGGCCATTACAGGG - Intergenic
999194593 5:149773540-149773562 TTGTGAGGAGGGACCTGGGAGGG - Intronic
999215943 5:149935102-149935124 TTGCTAGCAGGCAGCGTGCATGG + Intronic
1006065828 6:31462118-31462140 TTTCTAGGAGGGACCTAGGGTGG + Intergenic
1009304380 6:62070142-62070164 TTGCAAAGAGGGACCTCTCAGGG - Intronic
1009792819 6:68424771-68424793 TTTCAAGGATGGACCTTGGAAGG - Intergenic
1010403772 6:75479089-75479111 TTCCTAGGAGGGACCTTGTTAGG - Intronic
1026948211 7:74329740-74329762 TAACCAAGAGGGACCTTGCAGGG - Intronic
1028911472 7:96212556-96212578 TTACTAAGAGGGACCTTTGAGGG + Intronic
1031620113 7:123925329-123925351 TTGCTAGGAAGGACCTTATGAGG - Exonic
1035031312 7:155862970-155862992 TTCCCAGCAAGGACCTTGCAGGG + Intergenic
1039605367 8:38876075-38876097 TGGCAAGGAGGGAACTTGGAAGG - Intergenic
1047881710 8:129201697-129201719 TTACTTGGAGGAATCTTGCAGGG + Intergenic
1050627311 9:7518627-7518649 TTGCTCCTAGGGACCTAGCATGG - Intergenic
1051268826 9:15335007-15335029 TTGCTAGGAGGCACAAAGCAGGG - Intergenic
1053186913 9:36023957-36023979 TTGCTATGAGGGAATTTGCCGGG - Intergenic
1055843900 9:80537710-80537732 TTGCTAGTGGGGACTCTGCAGGG - Intergenic
1055925935 9:81509798-81509820 TTCCTAGAAGGGAGCTTGCCTGG - Intergenic
1057404348 9:94755301-94755323 TTGCTGAGAGAGGCCTTGCAAGG + Intronic
1057553003 9:96065792-96065814 TTGCTGGCAGGGACTCTGCAGGG - Intergenic
1057931585 9:99198149-99198171 TTGCTAGAATGGATCCTGCAGGG - Intergenic
1060214379 9:121729918-121729940 TTGCTGGGAGGAGCCTTCCAGGG - Intronic
1061413138 9:130431725-130431747 GTGCTAGGATTGGCCTTGCAGGG - Intronic
1189103216 X:38212125-38212147 TTGGTAACAGGGGCCTTGCATGG - Intronic
1192094947 X:68200785-68200807 TTGCTAGAAAGGAACTTGAAGGG - Intronic
1192436847 X:71148412-71148434 TTGCCAGGAGGGGCCTGGCCCGG + Intronic
1192907838 X:75570334-75570356 TTGATAGGTAGGACCTAGCAGGG + Intergenic
1197680009 X:129372593-129372615 TGGCTAGGAGAGATCTTGCAGGG + Intergenic
1199418744 X:147618662-147618684 TTGCTTTGGGGGAACTTGCAGGG - Intergenic