ID: 1177187686

View in Genome Browser
Species Human (GRCh38)
Location 21:17816410-17816432
Sequence GATGATTTGCCAGCAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177187686 Original CRISPR GATGATTTGCCAGCAAACAC TGG Intronic
900912718 1:5613136-5613158 GATGGTTTGCTAGCAACCATTGG - Intergenic
904098246 1:27999185-27999207 GATGAGTTGCCAGGACACAAAGG - Intronic
905910108 1:41647790-41647812 GATCTCTTGCCACCAAACACTGG + Intronic
908835234 1:68223084-68223106 GATGATTTGCCAACCCTCACTGG - Intronic
909094695 1:71272152-71272174 GATGTTTTTCCAGCAAAACCAGG - Intergenic
911935345 1:103962525-103962547 AATGATTTGCCATGAGACACAGG + Intergenic
922951790 1:229563979-229564001 GGTGATTTGCTAGCAATCTCTGG - Intergenic
923129410 1:231062188-231062210 AATGATATGCCAGGGAACACTGG + Intergenic
1063637296 10:7795320-7795342 GTAGCTTTGCCTGCAAACACAGG + Intronic
1067208998 10:44242887-44242909 GATGATTTGGCAGGGAACACTGG - Intergenic
1068851299 10:61744645-61744667 GCTGATATGCCAGCCAACATAGG - Intronic
1070295364 10:75156376-75156398 GATGACTTGCCTGAATACACTGG - Intronic
1076225993 10:128775847-128775869 GCTGATGTGCCAGCTAACATAGG + Intergenic
1079022503 11:16921152-16921174 GATGATCTGCCAGTGAACAGAGG - Intronic
1081645106 11:44784733-44784755 GATGATAACCCAGCAACCACCGG + Intronic
1083156302 11:60825346-60825368 CAAGAGTTGCCAGCAACCACTGG - Intergenic
1085621031 11:78038145-78038167 GAAAATTGGCCAGCAAAGACAGG + Intronic
1086719279 11:90100448-90100470 TATAATTTGCCAGCAAACCTAGG - Intergenic
1087169013 11:95031536-95031558 GATGAGTTCCCAGCAAACCCAGG - Intergenic
1087415647 11:97852047-97852069 AATGATTTTCCAGCAAATATAGG - Intergenic
1087660629 11:100983792-100983814 GATTTTTTTCCAACAAACACTGG - Intronic
1089021760 11:115222875-115222897 CATCATTTGTAAGCAAACACTGG + Intronic
1094334705 12:29335893-29335915 GATGATTAGGCAGTAAAAACAGG + Intronic
1105733537 13:23244932-23244954 TAGGATTCCCCAGCAAACACAGG + Intronic
1106851681 13:33800133-33800155 GCTGCATTGCCAGCAAGCACAGG + Intergenic
1107016603 13:35712417-35712439 GATGATTTTCCAGCCATCATGGG + Intergenic
1110460248 13:75737252-75737274 TATGATTTGCCAGCAATCGCAGG - Intronic
1116683413 14:48007329-48007351 AAGGCTTTGGCAGCAAACACTGG + Intergenic
1121353140 14:93190361-93190383 GATGATCTGCTATCACACACAGG - Intronic
1122419987 14:101569791-101569813 GATTATTTGCAATCAAACACAGG + Intergenic
1130676947 15:85961214-85961236 TATGAGATTCCAGCAAACACAGG - Intergenic
1130997182 15:88910440-88910462 GATGATCATCCAGGAAACACTGG + Intronic
1131031158 15:89186968-89186990 GCTGATTTTCCAGCCAGCACAGG - Intronic
1133556571 16:6911413-6911435 CATGCGTTGCCAGCAACCACAGG - Intronic
1137362526 16:47832012-47832034 GATGCTCTGCCAGCACACAGTGG + Intergenic
1138213064 16:55179387-55179409 GATGACTTGCAAGGAAACAGAGG - Intergenic
1139310372 16:66023445-66023467 GATGATATGTCAGCAACCCCTGG + Intergenic
1140881253 16:79200015-79200037 GATCATCTGGCAGCAACCACCGG - Intronic
1143881974 17:10036691-10036713 GTTAATTTCCCAGCAAGCACTGG - Intronic
1144712663 17:17412534-17412556 TATGAATGGCCAGGAAACACTGG - Intergenic
1152058424 17:78050605-78050627 GCCGCTGTGCCAGCAAACACAGG + Exonic
1155412253 18:25559503-25559525 GATGCTTTGGGAGCAAACAAAGG + Intergenic
1157455613 18:47826255-47826277 ACTGGTTTGCCAGCAAACAATGG - Exonic
1166566477 19:43768704-43768726 GATAATTTGAAACCAAACACTGG + Intronic
1167693795 19:51002521-51002543 GATGATTTTTCAGTAAACGCGGG - Exonic
925026571 2:612371-612393 TATGATATGCCAGAAACCACTGG + Intergenic
927372252 2:22369701-22369723 CATGATTGGCCAGCAACCTCTGG - Intergenic
929080394 2:38116660-38116682 TTTGATTTGCCAGGAAACAAAGG + Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932915029 2:75847909-75847931 GATAAATTGCCAGGTAACACTGG - Intergenic
933895273 2:86805592-86805614 GCTGAATAGCCAGCAAACATGGG - Intronic
934196874 2:89844524-89844546 GATGATGTGGCAGCAAACCCTGG - Intergenic
934789864 2:97049958-97049980 GAGGATGTGGCAGCCAACACTGG - Intergenic
934816605 2:97332581-97332603 GAGGATGTGGCAGCCAACACTGG + Intergenic
934821091 2:97375903-97375925 GAGGATGTGGCAGCCAACACTGG - Intergenic
935820484 2:106887665-106887687 GAGTATTTACCAGCAAACAAAGG - Intergenic
939017992 2:136923724-136923746 TATGAATAGCCAACAAACACAGG - Intronic
939343053 2:140926098-140926120 GATGTTATGCCAGCATACAGAGG - Intronic
941700802 2:168602678-168602700 CATGATTTGACATCAAAAACAGG + Intronic
944344773 2:198648887-198648909 GATGATGTGACAGGGAACACAGG + Intergenic
948127785 2:235577498-235577520 GATCATTTCCAAACAAACACAGG - Intronic
948949272 2:241238536-241238558 GATGGTTTTCCAGCAGAGACAGG + Intronic
1168959281 20:1857649-1857671 GATGATTTCCCAGCAAAAGCTGG - Intergenic
1174904930 20:54540422-54540444 GGTGATTTGCATGCAAACAAGGG - Intronic
1176958979 21:15138580-15138602 GATGCTTTGGCAGCACACTCAGG - Intergenic
1177187686 21:17816410-17816432 GATGATTTGCCAGCAAACACTGG + Intronic
1177349392 21:19915593-19915615 GATGTTTTACCACCAAACATTGG - Intergenic
1178717236 21:34976788-34976810 GATTATTTTACAGGAAACACTGG - Intronic
1179959161 21:44758622-44758644 TCTGATTTGCCAGCCTACACAGG - Intergenic
1182655632 22:31887594-31887616 GATGTTTTCCCAGGAAACATGGG - Intronic
1183599549 22:38832035-38832057 GAAGATCTGCCAGCAAGAACAGG + Intronic
951075510 3:18386539-18386561 GAAGGTTTACCAGCAAAGACTGG + Exonic
951780154 3:26353958-26353980 AAGGATTTTCCAGCAAACAGTGG - Intergenic
953567252 3:44043340-44043362 GCTGCTTTGACATCAAACACTGG - Intergenic
954917605 3:54162290-54162312 GATGAGGTCCCAGCAGACACAGG - Intronic
956387685 3:68738154-68738176 GATGATTAGCCAGAAAAGAAAGG + Intronic
956534439 3:70260193-70260215 AGTGGTTTGCCAGCAATCACAGG + Intergenic
964824557 3:160810680-160810702 GATGACCTGCCAGCAAATCCTGG + Intronic
966431685 3:179838044-179838066 TTTGATTTTTCAGCAAACACTGG - Intronic
968266459 3:197367091-197367113 AAAGATTTGCCAGCATACCCGGG - Intergenic
969927569 4:10599603-10599625 GGTTATTTCCCAGCAGACACAGG + Intronic
974140749 4:57883452-57883474 CAGGAGTTGCCAACAAACACTGG - Intergenic
974168596 4:58236645-58236667 GGTGATTTTCCAGCAAGCTCAGG + Intergenic
976597281 4:86906054-86906076 GATGATTAGTCAGCAAACCGGGG + Intronic
977486112 4:97648213-97648235 GATGTTTAGCCACCACACACTGG - Intronic
977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG + Intergenic
979771809 4:124534471-124534493 GATGATTTGATGGAAAACACAGG + Intergenic
981234243 4:142396335-142396357 GATGAATGGCCAGTAAGCACAGG + Intronic
982177505 4:152719722-152719744 GATGATCTGCCAGAACACAGTGG + Intronic
982473202 4:155818801-155818823 GATGATGAGTGAGCAAACACTGG + Intergenic
982900507 4:160994313-160994335 GATGTTTTGACAGCAAAGGCTGG - Intergenic
983272162 4:165575062-165575084 GAAGACATGCCAGCAAATACTGG + Intergenic
983436927 4:167727747-167727769 GATGATTAGCAAGCAAATACTGG + Intergenic
990788076 5:59445325-59445347 GAGTATTTGCCAGCATAAACTGG - Intronic
994286877 5:97979902-97979924 TATCTTTTTCCAGCAAACACTGG - Intergenic
995231739 5:109772463-109772485 GATGAATTGAGATCAAACACAGG + Intronic
999581290 5:153041031-153041053 GATGATTTCACAGCAAAACCTGG + Intergenic
1001005044 5:168042577-168042599 GAGGATTCTCCAGCAACCACAGG - Intronic
1004871873 6:19913294-19913316 GCAGATGTTCCAGCAAACACAGG - Intergenic
1013191651 6:107808863-107808885 GATGATTTAACAGAGAACACAGG + Intronic
1017332185 6:153212560-153212582 GATGATTTGAAAGGAAAAACAGG - Intergenic
1017350360 6:153433864-153433886 GGTGATTTGCCAGCAATCTTTGG + Intergenic
1017399728 6:154046411-154046433 GATAATTTGCCAGAAGGCACAGG - Intronic
1018146687 6:160898100-160898122 GGTGATTTGCCAGCAATCTTTGG - Intergenic
1022191168 7:28018125-28018147 GATGATGTTCCAGCCAAGACAGG + Intronic
1022369335 7:29756179-29756201 TTTGATTTGCCAGCTTACACTGG - Intergenic
1023162464 7:37310356-37310378 GATGAGTCCCCAGAAAACACAGG - Intronic
1024549806 7:50553204-50553226 CATGATTTTGCTGCAAACACCGG + Intronic
1028078047 7:86538984-86539006 TATGATTTTTCAGCAAACACAGG + Intergenic
1028533621 7:91865976-91865998 GAAGATTTGACAGCAGACTCTGG - Intronic
1028634661 7:92974085-92974107 GTTGTTCTGCCAGGAAACACAGG - Intergenic
1031291054 7:119935223-119935245 CATTATTTGGCAACAAACACAGG - Intergenic
1036389141 8:8309409-8309431 GATGGGTAGCCAGTAAACACTGG + Intergenic
1038461892 8:27724095-27724117 GATGACTTGCCATCAATCACAGG + Intergenic
1038863846 8:31416765-31416787 TATGTTTTGCCAGCATAAACAGG + Intergenic
1040700811 8:50062735-50062757 GATAATTTGCCCACAAACAATGG + Intronic
1041046329 8:53890228-53890250 GATGATTTGACAGAAGACTCAGG - Intronic
1041406739 8:57507859-57507881 GATGATTTGCAAGGAAAGCCAGG - Intergenic
1043880339 8:85535360-85535382 GATGATTTGCCAGCAGTCAGTGG + Intergenic
1044426369 8:92055614-92055636 TATGTTTAGCAAGCAAACACTGG + Intronic
1049372983 8:142276530-142276552 GAGCATTTGCCAGCAGAGACAGG + Intronic
1051340566 9:16106140-16106162 GATGATTTGCCTGCAGACTGAGG - Intergenic
1051689259 9:19691953-19691975 GATTGTTTGCAAGCAAACACTGG + Intronic
1057958894 9:99436029-99436051 GATGATATCCCAGCATACATTGG - Intergenic
1058986049 9:110208992-110209014 GATGGTTTGCTAGCAATCTCTGG + Intergenic
1061572934 9:131488819-131488841 GAAGATTTCTCAGCAGACACTGG - Intronic
1186824890 X:13329499-13329521 GATGCTTTGCCAACCAAGACTGG + Intergenic
1187040551 X:15590740-15590762 TATAATTTGCAAACAAACACAGG - Intronic
1187972028 X:24668364-24668386 GAAGACTTGGCAGCAAAGACTGG + Intronic
1190567732 X:51747876-51747898 GATGATTTCCCATCAAAAACTGG + Intergenic
1193541477 X:82777888-82777910 GATGTTTTGCCTAAAAACACTGG + Intergenic
1194942515 X:100028316-100028338 AATGATTTCCCAGCAGAAACTGG + Intergenic
1196182914 X:112714503-112714525 GAAGATTTGCAAGGAAACAGAGG - Intergenic
1197775351 X:130115136-130115158 GATGATTTGCAGGAAAACATGGG - Intergenic
1198026810 X:132715017-132715039 AATGATTTGCCAGCACAGAGGGG - Intronic
1199787494 X:151118054-151118076 GATGGTTTGCTGGCAATCACTGG + Intergenic
1200048633 X:153416426-153416448 GATGACCTGCCAGCCAACATTGG - Intergenic
1200957220 Y:8962300-8962322 GATGATTTGTCACCAAATAATGG - Intergenic
1201706483 Y:16943164-16943186 GATCATTTGCCACCACATACAGG - Intergenic
1202193560 Y:22271655-22271677 GATGATTTGTCACCAAATAATGG + Intergenic
1202201913 Y:22361418-22361440 GATGATTTGCCACCAAATAATGG - Intronic