ID: 1177192843

View in Genome Browser
Species Human (GRCh38)
Location 21:17870906-17870928
Sequence GACAGCTCTTTGACTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177192843_1177192845 11 Left 1177192843 21:17870906-17870928 CCAGTAGCAGTCAAAGAGCTGTC No data
Right 1177192845 21:17870940-17870962 GAGTACTTATCTGCAGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177192843 Original CRISPR GACAGCTCTTTGACTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr