ID: 1177194959

View in Genome Browser
Species Human (GRCh38)
Location 21:17894432-17894454
Sequence CAGTATGTGCATCTTATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177194956_1177194959 -8 Left 1177194956 21:17894417-17894439 CCCACAGCAGGGACACAGTATGT 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 152
1177194955_1177194959 -1 Left 1177194955 21:17894410-17894432 CCTTAGACCCACAGCAGGGACAC 0: 1
1: 0
2: 1
3: 24
4: 188
Right 1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 152
1177194957_1177194959 -9 Left 1177194957 21:17894418-17894440 CCACAGCAGGGACACAGTATGTG 0: 1
1: 0
2: 3
3: 35
4: 344
Right 1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 152
1177194950_1177194959 26 Left 1177194950 21:17894383-17894405 CCACAGGTCACTTCTGAAGGTGG 0: 1
1: 0
2: 1
3: 23
4: 172
Right 1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177194959 Original CRISPR CAGTATGTGCATCTTATTGT GGG Intergenic
906205031 1:43982070-43982092 CAGTGTGTGCATGTGAATGTTGG + Intronic
908266009 1:62380282-62380304 CAATATGTTAATGTTATTGTGGG + Intergenic
909667872 1:78155631-78155653 CAGTATATGCATCTTTTTCATGG - Intergenic
912053132 1:105557065-105557087 CAGTATGTGAAAAATATTGTTGG + Intergenic
915956570 1:160225119-160225141 CAGTATCTGCTCCTTATTGCAGG - Exonic
919317704 1:195996018-195996040 AAATAAGTGCATCTTATTTTGGG - Intergenic
919322277 1:196058379-196058401 CAGTCTCTGTATATTATTGTTGG + Intergenic
920652910 1:207852011-207852033 CATTATGTGCACCTTACAGTTGG - Intergenic
920954307 1:210603597-210603619 GAGTATGTGCATATTATTTTAGG - Intronic
922060775 1:222089165-222089187 CAGTATGTGCATATGCTTCTTGG - Intergenic
923765772 1:236891163-236891185 CAGTGTGTTCAGCATATTGTGGG - Exonic
1063429252 10:5975539-5975561 CAATATATGCAGTTTATTGTCGG + Intronic
1064730082 10:18321645-18321667 CAGTATGTGTATTTATTTGTGGG - Intronic
1066686445 10:37986191-37986213 CAGAATGTGTATTTTATTGTTGG - Intergenic
1067153891 10:43758734-43758756 CAGTGGGTGCATCTCATTGCTGG - Intergenic
1067157723 10:43796027-43796049 CTGTATGTGATTCTTATTTTTGG + Intergenic
1067410785 10:46062691-46062713 AAGGATGTGCATCTTTGTGTAGG + Intergenic
1069332890 10:67314095-67314117 AATTATGTGCATCTTCTTTTTGG - Intronic
1069658077 10:70105276-70105298 CAGGATGTGGATGTGATTGTAGG + Intronic
1069910571 10:71756537-71756559 GAGTATGTGCATTTTCTTTTAGG + Intronic
1074340114 10:112620166-112620188 TAGAATTTGCATCTTATTGTTGG + Intronic
1075052677 10:119194528-119194550 CAGGATTTGCATCTTTGTGTGGG + Intergenic
1075640733 10:124062556-124062578 CACTATGGGCATATTTTTGTGGG - Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077946280 11:6903602-6903624 CATTATTTGCAGCTTATTTTTGG - Intergenic
1080583519 11:33662426-33662448 CAGTCTGTGAATCTGAATGTGGG + Intronic
1081318084 11:41656060-41656082 GAGTATTTCCATCTTATTGTGGG + Intergenic
1086163449 11:83749377-83749399 CAGGATTTGCATCTTTTTCTTGG - Intronic
1086758044 11:90590420-90590442 CAGTATGTGCATGTCAATGCAGG + Intergenic
1091098809 11:132850202-132850224 CAGGATGTGCATCTCATGGAAGG + Intronic
1095804759 12:46306929-46306951 GAGAATGTGCATTTTGTTGTTGG - Intergenic
1097859828 12:64507787-64507809 CAGTTTATGCATCATATTTTAGG + Intergenic
1099416733 12:82397267-82397289 CAGTGTGTATATCTTATTTTGGG + Intronic
1099623816 12:85040913-85040935 CAGTATATACATCTTTTTTTGGG + Intronic
1099676060 12:85761953-85761975 AATTATGTACATTTTATTGTAGG + Intergenic
1103142965 12:118566650-118566672 CACTATGTGAATGTTTTTGTTGG + Intergenic
1104769303 12:131351090-131351112 CAGCATGGGCATCTGAATGTGGG - Intergenic
1106731082 13:32542012-32542034 CAGAATGTGCTACTTTTTGTAGG + Intergenic
1107055709 13:36101142-36101164 CAGTTTGTGCAGCGTATTGAGGG + Intronic
1108546266 13:51498172-51498194 CAGTATCTGCCTCTTAGTGATGG - Intergenic
1109418889 13:62083619-62083641 CAGTGTGTGCTTCTTATAATTGG - Intergenic
1114315206 14:21503469-21503491 TAGGATGTGCATCATCTTGTAGG + Exonic
1116194355 14:41703664-41703686 GAGAATGTGCACATTATTGTAGG - Intronic
1117635083 14:57734377-57734399 CATTTTGTGCAACTTATTTTGGG - Intronic
1121447831 14:93989296-93989318 CAGTCTGTGCTTCTTATCCTGGG - Intergenic
1122502207 14:102208245-102208267 CAGTAGGTGCATCTGAATCTGGG - Intronic
1126952437 15:53896466-53896488 CAGTATTTTCTTCTTAATGTTGG + Intergenic
1127825282 15:62697560-62697582 CTGTATGTGCCTCTTTTAGTTGG + Intronic
1129456010 15:75676541-75676563 CAGTATGGGCATCTCCTGGTGGG - Exonic
1130198833 15:81806720-81806742 AAGTTTCTGTATCTTATTGTTGG + Intergenic
1130891280 15:88135878-88135900 CTGTAAGTGCATGTTATTGTGGG - Exonic
1131304138 15:91226341-91226363 CACTCTGTGCATCTTCTTCTGGG - Exonic
1149186855 17:54008319-54008341 CAATACATGCATCTTATTTTGGG - Intergenic
1150425104 17:65070960-65070982 CAGTATATGCAACTTTGTGTTGG - Intergenic
1153009421 18:524562-524584 CAGTTTGTGCAGATTATTTTTGG + Intergenic
1155201162 18:23519077-23519099 CAATATGTGCATCTTTTTACAGG - Exonic
1155370906 18:25099391-25099413 GAGTATTTTCATCTTATTTTGGG - Intronic
1155566686 18:27143454-27143476 CAGTAATTTCATGTTATTGTGGG - Intronic
1156097623 18:33554003-33554025 GGATATGTGCATCTTTTTGTTGG - Intergenic
1157014137 18:43689555-43689577 CAATATGTTCATGTTATTATTGG + Intergenic
1157156554 18:45272867-45272889 CAGTAGGTGCATATATTTGTGGG - Intronic
1157512033 18:48282613-48282635 CAATGTCTGCATCTTATTGTAGG - Intronic
1159616719 18:70589049-70589071 CAGTATTTGCTTTATATTGTTGG + Intergenic
1160531338 18:79566686-79566708 TACAATGTGCCTCTTATTGTGGG - Intergenic
1167200397 19:48061315-48061337 CAGTATCTGCCACTTACTGTGGG - Intronic
926879743 2:17531271-17531293 CAGTATGTGAATATTACTCTAGG - Intergenic
926994707 2:18722012-18722034 TGGTATGTGCACCTTATTTTAGG - Intergenic
929077393 2:38089442-38089464 CAGTATGTCCATCTGAGTATGGG + Intronic
929800835 2:45100202-45100224 ACATATGTGCAGCTTATTGTTGG + Intergenic
932312774 2:70757196-70757218 CAGTACATGCATATTATTTTGGG + Intronic
933192229 2:79347636-79347658 CAGTATGTACATGTAATGGTTGG - Intronic
935954096 2:108358086-108358108 AAGAATGTGCATCATGTTGTTGG + Intergenic
938655325 2:133425669-133425691 CAGAAGATGCATATTATTGTGGG + Intronic
939985104 2:148822266-148822288 CATTATGTGCATCTTGATGGAGG + Intergenic
941448409 2:165629435-165629457 CAGTTTGTGCATCTCATTCACGG + Intronic
941706996 2:168669450-168669472 CAGTATGTTCAACTTAATGTTGG + Intronic
942063060 2:172245987-172246009 CTGTTTGTGCAGGTTATTGTGGG + Intergenic
943114699 2:183653640-183653662 AAATATGTGCATTTTATTGTAGG - Intergenic
943118333 2:183703199-183703221 CAGTATGGTCATTTTAATGTTGG - Intergenic
945994734 2:216426424-216426446 CATTATGTGCATTTTTTTCTGGG - Intronic
1170370940 20:15647466-15647488 CATTTTGTGCATCCTAATGTGGG - Intronic
1171114168 20:22509993-22510015 CAGCATGTGCATGTATTTGTTGG - Intergenic
1173315591 20:41940378-41940400 AAATATGTCCATCTTATAGTGGG + Intergenic
1174641406 20:52047666-52047688 CATTATTTGCATCATAGTGTAGG + Intergenic
1174674786 20:52343257-52343279 GAGTATGTGCATTTAAATGTTGG + Intergenic
1175524282 20:59622818-59622840 CAGGATGTGCATCTCCTGGTGGG - Intronic
1175617866 20:60418007-60418029 CAGCATTTGTATCTTCTTGTTGG + Intergenic
1176723999 21:10414789-10414811 CACTTTCTGCATCCTATTGTAGG + Intergenic
1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG + Intergenic
1177721557 21:24913863-24913885 CAATAAGTGCAGCTTAGTGTGGG - Intergenic
1180305244 22:11067963-11067985 CACTTTCTGCATCCTATTGTAGG + Intergenic
1181081869 22:20420957-20420979 CAGTGAGTGCATCTTAGGGTGGG + Intergenic
1185226037 22:49653350-49653372 CAGTGTCTGCATCTCATTATCGG - Intronic
949113533 3:292533-292555 CAGTAGGTAAATCTTATTGGGGG + Intronic
949188465 3:1221657-1221679 CAGAATTTGCTTCATATTGTGGG + Intronic
949389534 3:3543882-3543904 CAGAATGTGAATCTCACTGTGGG - Intergenic
949841502 3:8325127-8325149 CTGTGTGTGCATCTTATTGGTGG + Intergenic
955647823 3:61159370-61159392 CAGCTTGTGCACCCTATTGTGGG - Intronic
956299596 3:67756390-67756412 CAGTAAGTGCAATTTATTTTAGG + Intergenic
956597593 3:70984881-70984903 CATTTTCTGGATCTTATTGTGGG - Intronic
956993493 3:74796388-74796410 CAGTGTGTGTCTTTTATTGTGGG - Intergenic
958568414 3:95846447-95846469 CAGTATGTCCATTGTATTGAAGG + Intergenic
964905058 3:161709239-161709261 CAGTATGTGCCTTTTATTTTGGG - Intergenic
965883498 3:173414979-173415001 CTCCATCTGCATCTTATTGTGGG - Intronic
967555585 3:190853753-190853775 CAGGATGTGCAAATTATTCTGGG + Exonic
968245332 3:197140522-197140544 AAGTATGTGCAACTTGTCGTTGG + Intronic
968649938 4:1756530-1756552 CTGTATGCCCATTTTATTGTGGG - Intergenic
971336875 4:25731355-25731377 AAATATGTGCAGCTTATGGTGGG - Intergenic
971482863 4:27129707-27129729 CAGAATGTTCAGCATATTGTAGG - Intergenic
974118894 4:57613923-57613945 CAGTTTCTGCATCTTAATATGGG + Intergenic
974222081 4:58987955-58987977 CAGTCTGTGCATTTTTCTGTAGG - Intergenic
975012029 4:69367520-69367542 CACTTTGTTCATCTTAATGTTGG - Intronic
975886083 4:78966594-78966616 CTTTATGTGCATTTTATGGTAGG - Intergenic
976269963 4:83220838-83220860 TATTATGTCCATTTTATTGTTGG + Intergenic
978524225 4:109648374-109648396 CAGTAGGTGGAAGTTATTGTTGG + Intronic
981826247 4:148944890-148944912 CAGTATTTGTATCTGATTTTTGG + Intergenic
983266225 4:165511011-165511033 AAGTCTGTTTATCTTATTGTAGG - Intergenic
986830334 5:11570001-11570023 TAGTATGTGCATCTTGTCTTAGG - Intronic
987302891 5:16612292-16612314 CAGTATGGGCATTTTATTGGTGG + Intronic
989606348 5:43247701-43247723 CAGTATGTGCAAGTTGCTGTAGG - Intronic
990565726 5:57026584-57026606 AAATATGTGCAGCTTATTGTAGG + Intergenic
991640012 5:68742836-68742858 GAGTATGTACATCTTATTACAGG - Intergenic
995070888 5:107920413-107920435 CAGGATGTGAATCTTAGTATAGG + Intronic
996980814 5:129491871-129491893 CAATATTTGCATTTTCTTGTGGG + Intronic
997257973 5:132443812-132443834 CAGTAAGTACAGCTTATTGAAGG - Intronic
998452166 5:142243319-142243341 CTGTATCTGCATATTATTTTGGG + Intergenic
1000897254 5:166870353-166870375 ATATATGTGCATTTTATTGTAGG - Intergenic
1004600873 6:17148816-17148838 TGGAATGTGCATCTTATTGTGGG - Intergenic
1008085228 6:47237515-47237537 TAGTATCTAAATCTTATTGTAGG - Intronic
1013437532 6:110126002-110126024 CAGTACAGGCATCTTATTTTAGG - Intronic
1014748190 6:125224594-125224616 CAGTATCTGCATTTTAATCTTGG + Intronic
1018894093 6:168001458-168001480 ATGTATGTGCCTCTTATGGTGGG - Intronic
1019003816 6:168779516-168779538 CGGGATGTGCATCTTAGGGTAGG - Intergenic
1020381810 7:7556020-7556042 TAGTATGTGTATCTATTTGTGGG + Intergenic
1022551331 7:31242268-31242290 CAGCATCTGCATCTTTTGGTTGG - Intergenic
1035720987 8:1791723-1791745 CATCATGTGCATGTTTTTGTGGG + Intergenic
1036926542 8:12912156-12912178 TAGAATTTGCATCTGATTGTTGG - Intergenic
1037292443 8:17365637-17365659 GAGTATTTGCTTCTTATTGGAGG - Intronic
1037824631 8:22154009-22154031 CAGTGTCTGCAGGTTATTGTTGG + Exonic
1038569331 8:28646935-28646957 CACTAAGTGAATCTTACTGTGGG + Intronic
1040578227 8:48673287-48673309 CATTATTTGCAACTTTTTGTTGG + Intergenic
1043465679 8:80504641-80504663 CAGTATGTGCATATTCTCTTAGG - Intronic
1043950676 8:86305948-86305970 AAGAATGTGCATCTAATTATGGG - Intronic
1044561262 8:93614519-93614541 CAGTTTATCCATCTTATGGTGGG - Intergenic
1044756577 8:95468736-95468758 CAGTTTTTGCAGCTTGTTGTGGG + Intergenic
1044848774 8:96407765-96407787 CAGTATGGGCAATTTATTGCAGG + Intergenic
1045334769 8:101189966-101189988 AAGTATGTGCATATAATTGATGG + Intronic
1047551858 8:125882532-125882554 CTGTAAGTGCATATTATTTTGGG + Intergenic
1051796263 9:20874349-20874371 CAGTGTTTGCATTTTATTTTTGG + Intronic
1056243826 9:84674361-84674383 CTCTATGTGCAATTTATTGTTGG + Intronic
1056382120 9:86064940-86064962 CAGTAAGTGCATCTGATTGGAGG - Intronic
1056506386 9:87262106-87262128 CAGTATTTCCTTCTTTTTGTGGG + Intergenic
1058539343 9:105995334-105995356 TAATATGTGCATCTTGTTTTAGG + Intergenic
1058552609 9:106131516-106131538 AATTAAGTGCATCTTATTATTGG - Intergenic
1186489672 X:9961662-9961684 CAGTAAGTACATGTAATTGTTGG + Intergenic
1187887422 X:23902585-23902607 CAGTATTTGCATTCCATTGTAGG - Intronic
1188378763 X:29465880-29465902 CAGTATGAGCATCCTATTGGTGG - Intronic
1190063421 X:47224862-47224884 CAGTTTGTCCAGCTTAATGTAGG - Exonic
1190949416 X:55128207-55128229 CAGTATCTGCAATTTATTGAAGG - Intronic
1192151110 X:68712964-68712986 CAGTATGTGCAGCTTTTTGAAGG + Exonic
1192889037 X:75368420-75368442 AAGTATATGCATATAATTGTTGG - Exonic
1194151189 X:90326446-90326468 CAGTATGGCCATGTTTTTGTGGG - Intergenic
1195037501 X:100983200-100983222 CAGTTAGTGCATTCTATTGTTGG - Intronic
1195143715 X:101991007-101991029 CAGTGAGTGCATAATATTGTAGG + Intergenic
1196698588 X:118641137-118641159 CATTATGTGCATCTTCGTGTTGG + Intronic
1197190681 X:123644310-123644332 TAATATGTGCATCATATTATGGG - Intronic
1199085904 X:143630638-143630660 CAGTTTGTGGAGCTTATTGAAGG + Exonic
1199669844 X:150135239-150135261 GAATTTGTGCATCTTCTTGTAGG - Intergenic
1200421647 Y:2976058-2976080 CAGTATGTGGCTTTTTTTGTGGG + Intronic
1200497559 Y:3903200-3903222 CAGTATGGCCATGTTTTTGTGGG - Intergenic