ID: 1177196682

View in Genome Browser
Species Human (GRCh38)
Location 21:17910981-17911003
Sequence GAGCCAATTGTTAAGTTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 9, 2: 27, 3: 95, 4: 368}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177196682 Original CRISPR GAGCCAATTGTTAAGTTTTT AGG Intronic
901381568 1:8878201-8878223 TAGCCAAGTGTAAGGTTTTTGGG - Intronic
901580786 1:10241264-10241286 CAGCTAATTTTTAATTTTTTTGG + Intronic
901683229 1:10928345-10928367 GAGCCAGTTGTTAGGTTTTGAGG - Intergenic
902206964 1:14875638-14875660 GAGCCAATAGTTACATTTTCAGG + Intronic
902986690 1:20158853-20158875 GAGCCACTTGAAAAGTTGTTGGG + Intergenic
903663376 1:24992392-24992414 GAGGCAATTGTGAAATATTTGGG - Intergenic
904223202 1:28990580-28990602 CAGCTAATTTTTAAATTTTTTGG + Intronic
904570459 1:31460320-31460342 GATCAAATTGATCAGTTTTTAGG + Intergenic
904634702 1:31870826-31870848 GAGCCAATTGTTACATCTTCAGG - Intergenic
905289079 1:36909175-36909197 GAGCCAATTGTTAAATTTTCAGG + Intronic
906445151 1:45889914-45889936 GAGCTAATTTTTATATTTTTAGG + Intronic
907184124 1:52596132-52596154 GAGTCAATTGTTATGTTTCCAGG + Intergenic
907543181 1:55235089-55235111 GAGCCAATTGTTAAATTTTTAGG + Intergenic
907998888 1:59660841-59660863 TAGACAATGGTTAAGCTTTTAGG - Intronic
908041559 1:60119194-60119216 CAGCCAATTTTTTATTTTTTGGG + Intergenic
908814882 1:68021598-68021620 GAGTCAATTGTTACATATTTGGG - Intergenic
909814548 1:79975672-79975694 GAGCTGATTGTTAAATTTTCAGG - Intergenic
910696798 1:90027332-90027354 AAGCCATTTCTTATGTTTTTAGG + Exonic
910776015 1:90875877-90875899 GAAACAAATGTAAAGTTTTTCGG - Intergenic
912336752 1:108869857-108869879 CAGCTAATTTTTAAATTTTTTGG + Intronic
915297684 1:154932945-154932967 CAGCTAATTTTTAAATTTTTTGG - Intronic
915644771 1:157261853-157261875 CAGGCAATTGTTAAACTTTTTGG - Intergenic
916726514 1:167528308-167528330 GAGCCAACTGTTAAATTTTCAGG + Intergenic
916760200 1:167809290-167809312 TGTCCAATTGTTAAGTCTTTTGG - Intergenic
917208925 1:172610787-172610809 GATCCAGTTGGCAAGTTTTTAGG - Exonic
917404739 1:174693321-174693343 CGGCCAATTGTTAAATTTTCAGG + Intronic
917664599 1:177212600-177212622 GAGCCCATTGTAAAATTTTCAGG + Intronic
917796744 1:178538294-178538316 GGGCCCATGGTTAAGTATTTGGG - Intronic
918437056 1:184526288-184526310 GATTCTATTGTTCAGTTTTTTGG - Intronic
920148989 1:203888381-203888403 TAGCTAATTGTTTTGTTTTTTGG + Intergenic
920224549 1:204428829-204428851 TAGCAAAATGTTAAGTGTTTAGG + Intronic
920277703 1:204819783-204819805 GAGCTGATTGTTAAATTTTCAGG + Intergenic
921025951 1:211282014-211282036 TAGCAAATTCTTAAGTTTTCAGG - Intronic
921665099 1:217859568-217859590 CAGCCAATTTTTAAACTTTTTGG + Intronic
922019864 1:221692713-221692735 GAGCTGATTGTTAAATATTTTGG + Intergenic
924168984 1:241317341-241317363 GAGCCAATTGCTAAATTCTCAGG - Intronic
924329871 1:242930918-242930940 GAAACAATTGTTAAATTTTCAGG - Intergenic
1064270429 10:13860398-13860420 GAGCCAATTGCTACATTTTCAGG - Intronic
1065022586 10:21512620-21512642 AAGCCAATTGTTTAGCTTTCTGG + Intergenic
1065627355 10:27645355-27645377 GAACCAATTGTTAAATTTTCAGG - Intergenic
1065933336 10:30498720-30498742 GAGCATTTTGTTAAATTTTTAGG - Intergenic
1066063557 10:31745432-31745454 CAGCTAATTTTTAAGTTTTTTGG - Intergenic
1066383806 10:34924281-34924303 GAGCCCATTGTTAAGTTTTCAGG + Intergenic
1066414266 10:35205656-35205678 GAGCCTATTATTAAATTTTCAGG + Intronic
1067064972 10:43098937-43098959 AATTCAATTTTTAAGTTTTTGGG + Intronic
1067272701 10:44805784-44805806 GAGCCAATTGCTTAGGTTATTGG + Intergenic
1067799451 10:49349038-49349060 GAGCCAAATGTGAGGTGTTTGGG - Intergenic
1067971578 10:50976818-50976840 TAGCCAATTATTTAGTGTTTTGG - Intergenic
1068354141 10:55889237-55889259 GAGCTAATTGTTAAAGTTTTAGG - Intergenic
1068544534 10:58331018-58331040 AAGCCAATTGTCATGTTGTTAGG + Intergenic
1068782452 10:60935637-60935659 GAACTAGTTGTTAAATTTTTAGG + Intronic
1070113734 10:73509258-73509280 GAGATTATTGTTAATTTTTTAGG + Intronic
1070766559 10:79059965-79059987 GGGCCGATTGTTAAATTTTCAGG + Intergenic
1070837041 10:79454589-79454611 GAGCCAATTGCTAAATTTCGGGG + Intergenic
1071104477 10:82078680-82078702 GAAATAATTGTTAAGGTTTTGGG - Intronic
1071368375 10:84925077-84925099 GAGCATATTGTTAAATTTTCAGG - Intergenic
1071493652 10:86153326-86153348 GAGCCTATTGTTAAATTTTCAGG + Intronic
1071721428 10:88150324-88150346 GAGCCAATAGTTAAATTTTTAGG + Intergenic
1073644145 10:105282381-105282403 GAGCCAGTTGTTAAATTTTCAGG - Intergenic
1074371378 10:112903354-112903376 GAAACAATTATTAAGTTTTCAGG + Intergenic
1074613935 10:115047535-115047557 GGGCCAATTGTTTCATTTTTAGG + Intergenic
1076226407 10:128779740-128779762 GAGCCAGTTGTTAAATTTTCAGG + Intergenic
1077588974 11:3477122-3477144 GAGTCAATTGAAAAGTTGTTAGG - Intergenic
1077771296 11:5221804-5221826 GTGCCATTTGTTAAGCTTGTTGG + Intergenic
1078120550 11:8504433-8504455 GAGCCAATTGTTAAATTTTCAGG + Intronic
1078585681 11:12586412-12586434 GAGCTGATTGTTAAATTTTTAGG - Intergenic
1079345493 11:19648077-19648099 GAGCCAGCTGTTAATTTTTCAGG + Intronic
1079761527 11:24335572-24335594 GAGGAAATTGTTCAATTTTTAGG - Intergenic
1080113279 11:28593788-28593810 GAATCAATTGTGAAGTATTTGGG - Intergenic
1080550035 11:33366283-33366305 GAGCCAATTGTTAAATTTACAGG - Intergenic
1080625413 11:34025074-34025096 GGATCAATTGTTAAATTTTTAGG + Intergenic
1081708511 11:45201330-45201352 GAGCCAACTGTTAAATTTTCAGG - Intronic
1084222690 11:67694053-67694075 GATCAAATTGATCAGTTTTTAGG - Intergenic
1084583571 11:70039978-70040000 GAGCAAATCGATCAGTTTTTAGG + Intergenic
1085025879 11:73236355-73236377 GAACCAATTGTTAAATTTTCAGG - Intergenic
1085770219 11:79318804-79318826 GAACCAAGTGTTAATTTTTCAGG - Intronic
1086449528 11:86902248-86902270 GAGCAAATAGATAAGGTTTTAGG - Intronic
1087819512 11:102696031-102696053 GAGTCTATTGTTAAATTTTCAGG - Intronic
1087858839 11:103128163-103128185 GAGACAATTTGAAAGTTTTTAGG + Intronic
1087870034 11:103281806-103281828 GATACCATTTTTAAGTTTTTGGG + Intronic
1088616263 11:111632126-111632148 AAGCCAAATGTGAAGTTCTTAGG - Intronic
1088798005 11:113280860-113280882 GAGCCAATTGCTAACTTTTCAGG - Intergenic
1088929703 11:114339300-114339322 GAGGTATTTGTTAAGTTCTTTGG - Intergenic
1089241392 11:117084238-117084260 GCTCCCATTATTAAGTTTTTTGG + Intronic
1090063581 11:123484679-123484701 GAGCCAATTTCTGAGGTTTTGGG - Intergenic
1090823412 11:130365472-130365494 GAGCTGATTGTTACGTTTTCAGG + Intergenic
1093144187 12:15544686-15544708 GAACCAAGTGTGAAGTTGTTTGG - Intronic
1093633110 12:21433622-21433644 GAGCTGATTGTTAAAATTTTAGG - Intergenic
1093752435 12:22816161-22816183 GAGGAAATTTGTAAGTTTTTAGG - Intergenic
1094044478 12:26152460-26152482 GAGCCAGTTCTTAAATTTTCAGG - Intronic
1094140508 12:27176165-27176187 GAGCCAATTGTTTAATTTATAGG + Intergenic
1095199076 12:39361279-39361301 CAGCCAAGTGTAAATTTTTTCGG - Intronic
1095336290 12:41031544-41031566 AATCCAATTGTTAAATTTTTAGG - Intronic
1095480846 12:42633914-42633936 GAGCCAATTATTAAATTTCTAGG + Intergenic
1095728850 12:45482723-45482745 CAGCCATTTGTTAACTTCTTTGG - Intergenic
1096287521 12:50313326-50313348 GAACCAATTGTTACGGTTTTAGG - Intergenic
1096438511 12:51617228-51617250 GATACAAATGTTAAGTCTTTTGG + Intronic
1098194394 12:67984675-67984697 TAGCTAATAGTTAAATTTTTTGG + Intergenic
1098234646 12:68406770-68406792 GAGCCAATTGCTAAATATTTAGG + Intergenic
1098245740 12:68515599-68515621 GAGCCAATTGTTAAAATTTAAGG + Intergenic
1098427683 12:70383904-70383926 CAGCTAATTTTTATGTTTTTAGG - Intronic
1099177967 12:79443723-79443745 AAGCCAATTGTTAAGCTTAGTGG + Intronic
1099683172 12:85855054-85855076 GAGCCAGTAGTTAAGTTTGATGG - Intergenic
1101586988 12:106093780-106093802 GAGTCTTTTGTTGAGTTTTTTGG + Intronic
1102121525 12:110445721-110445743 AAACCAATTGTTAAATTTTGAGG + Intronic
1102626325 12:114238273-114238295 GAGCCAACTGTTAAATTCTCAGG - Intergenic
1103806991 12:123581509-123581531 CTGTCAATAGTTAAGTTTTTGGG + Intergenic
1104351867 12:128051070-128051092 GAGGCAATTGTTAAATTTCCAGG + Intergenic
1104588482 12:130066097-130066119 GGGCCAAATGTTAAATTTTCAGG + Intergenic
1104684217 12:130773891-130773913 GAGCTCATTCTTAGGTTTTTAGG + Intergenic
1105663319 13:22524048-22524070 GAGCTAATTTTTAAATTTTTTGG + Intergenic
1105768512 13:23584710-23584732 CAGAAAATTTTTAAGTTTTTAGG + Intronic
1106313390 13:28573286-28573308 GAGGAAATTGGTGAGTTTTTGGG + Intergenic
1106317351 13:28606529-28606551 GAGCCAATCATTAAGTTTTCAGG - Intergenic
1107293863 13:38888925-38888947 GAGTTAATTGTTAAATTTTCAGG - Intergenic
1108243467 13:48491763-48491785 GATCCAAGTGATAACTTTTTAGG - Intronic
1108415386 13:50193199-50193221 GAGCTGATTGTTAAGTTTAGGGG + Intronic
1109164578 13:59018051-59018073 GAGTCATTTCTTAAGTTATTAGG + Intergenic
1110148211 13:72220588-72220610 GAGGCTATGGTGAAGTTTTTTGG + Intergenic
1110306491 13:73993744-73993766 GAGCCAATTGTTGAATTTTAAGG + Intronic
1111449812 13:88400423-88400445 CAGCCAATGGGTAAGTCTTTGGG - Intergenic
1111825816 13:93265750-93265772 GAGCCAACTGTTACATTTTTAGG + Intronic
1113859812 13:113474023-113474045 CAGCCAACTGTAATGTTTTTGGG - Intronic
1113918613 13:113890342-113890364 CAGCTAATTTTTAAATTTTTTGG + Intergenic
1114184498 14:20389969-20389991 GAGCTGATTGTTAAGTTTTCAGG + Intronic
1115328438 14:32167784-32167806 GAGCCAATTGTTAAATTTGCAGG + Intergenic
1115695156 14:35889926-35889948 AAGCCAATTGTTAAATTTTCAGG - Intronic
1116017718 14:39427327-39427349 GAGCCTCTTTTTCAGTTTTTAGG + Intronic
1116557929 14:46336958-46336980 GAGCCAGTTGTCATGTTTTGAGG + Intergenic
1116798892 14:49421604-49421626 GAGCCTATTGTTAAAATTTCAGG - Intergenic
1116983999 14:51200637-51200659 CAGCCAATTTTTATGTTTTTAGG + Intergenic
1116985194 14:51211574-51211596 AAACCAATTGTTAAATTTTCAGG - Intergenic
1117855756 14:60030779-60030801 AAGTCAATTGGTAAATTTTTAGG - Intronic
1118210885 14:63764783-63764805 CAGCTAATTTTTAAATTTTTTGG - Intergenic
1118386957 14:65263888-65263910 GAACCAATTGTTAAATTTTCAGG + Intergenic
1119146576 14:72320413-72320435 CAGCTAATTTTTAATTTTTTTGG - Intronic
1120549397 14:85850574-85850596 GAGCCCATTGTTAAATATTTAGG - Intergenic
1120686111 14:87539826-87539848 GACCAAATTGTTAATTCTTTTGG - Intergenic
1120740885 14:88107587-88107609 GAGCTGATTGTTAAATTTTCAGG - Intergenic
1121079815 14:91098593-91098615 GAGCTGAGTGTTAAATTTTTGGG - Intronic
1123143610 14:106107442-106107464 GTGCCAATTCATAAGTTCTTGGG - Intergenic
1123497644 15:20844585-20844607 GAGCCATTTAGTAAATTTTTAGG - Intronic
1125042919 15:35212746-35212768 GAGCCAGTTTTAAAGGTTTTAGG - Intergenic
1125097113 15:35867523-35867545 GAGCCAATTGTTAATTTCTCAGG + Intergenic
1125327598 15:38552773-38552795 GAGCAGATTGTTAAATTTTCAGG - Intronic
1125354776 15:38805478-38805500 GAGCCAACTGTTAAATGTTCAGG - Intergenic
1125369530 15:38956936-38956958 GAGCTGATTGCTAAGTTTTCAGG + Intergenic
1125884609 15:43219410-43219432 GAGCCAATTGCTAAATTTTGAGG - Intronic
1126680775 15:51199988-51200010 GAGCCACTTGTTAAGTTTTCAGG - Intergenic
1127799494 15:62465595-62465617 GAGCCAATGGAGAAGGTTTTGGG + Intronic
1127814371 15:62594368-62594390 CAGCTAATTTTTAATTTTTTTGG + Intronic
1128407075 15:67353312-67353334 AAGCCAATTTTTAATTATTTTGG - Intronic
1128622832 15:69166228-69166250 GAGCAAATTATTAAATGTTTAGG - Intronic
1130038207 15:80380663-80380685 GAGCCCATTGTTACATTTTCAGG + Intronic
1130272157 15:82457656-82457678 GAGCCAACTGTTGAATTTTCAGG - Intergenic
1130312804 15:82769914-82769936 GAGCCACTTGGCCAGTTTTTAGG - Intronic
1130464509 15:84185009-84185031 GAGCCAACTGTTGAATTTTCAGG - Intergenic
1130488178 15:84409795-84409817 GAGCCAACTGTTGAATTTTCAGG + Intergenic
1130499758 15:84488528-84488550 GAGCCAACTGTTGAATTTTCAGG + Intergenic
1130586801 15:85189623-85189645 GAGCCAACTGTTGAATTTTCAGG - Intergenic
1132249748 15:100326521-100326543 CAGCCAATTGTTAACTGTGTGGG + Intronic
1132290054 15:100693764-100693786 GAGACAATTGTTCAGTGTGTGGG + Intergenic
1132307679 15:100828375-100828397 GAGCCAATTGTTAAATATTTGGG + Intergenic
1202963221 15_KI270727v1_random:145422-145444 GAGCCATTTAGTAAATTTTTAGG - Intergenic
1133432832 16:5753583-5753605 GAGCCGATTGTGAAATTTTAAGG + Intergenic
1135051667 16:19198098-19198120 GAGCCAATTGTTAAGTTTTCAGG + Intronic
1135564591 16:23502068-23502090 GAGCCAATTCTAAAGTTTTTTGG - Intronic
1135961033 16:26994729-26994751 GAGCCATTTATAATGTTTTTTGG + Intergenic
1136161954 16:28425917-28425939 CAGCCAATTTTTATATTTTTAGG - Intergenic
1136201012 16:28689071-28689093 CAGCCAATTTTTATATTTTTAGG + Intronic
1136217353 16:28803257-28803279 CAGCCAATTTTTATATTTTTAGG + Intergenic
1137399827 16:48144239-48144261 GAGCCAATTGTTAAATTTTCAGG + Intronic
1137743735 16:50805601-50805623 GAGCCCATTATTAAATTTTCAGG - Intergenic
1138320976 16:56111561-56111583 TAGCCAATTATTAAGCTGTTGGG + Intergenic
1138428680 16:56953441-56953463 GAGTCAATTGTTAAATTTTCAGG + Intergenic
1138706853 16:58923791-58923813 GAGCTAATTGCTAAATTTTTAGG + Intergenic
1138714238 16:59003358-59003380 GAGCCAATTGTTAAATTTTCAGG - Intergenic
1138742150 16:59323462-59323484 GAGCTAACTGTTAAGTTTTCAGG + Intergenic
1138930363 16:61647596-61647618 AAGCCAAATGTTAATTTCTTGGG - Exonic
1138930381 16:61647744-61647766 AAGCCAAATGTTAATTTCTTGGG - Exonic
1139166360 16:64569598-64569620 GAGCGAACTGTTAAACTTTTGGG - Intergenic
1140737835 16:77914143-77914165 GAGCCAATTGTTAAATAATCAGG + Intronic
1140772487 16:78217599-78217621 GAGCCCTCTGTTAAGTTTCTCGG - Intronic
1140908985 16:79434448-79434470 GAGCCAATTGTTACATTTTCAGG - Intergenic
1141281945 16:82636863-82636885 GAGCCCCTTGTTAAGTTTTTAGG - Intronic
1141411768 16:83839388-83839410 CAGCCAATAGTTAAGTTTTGAGG + Intergenic
1142841465 17:2634674-2634696 GAGCCATTAGATAAGATTTTAGG - Intronic
1143104426 17:4521592-4521614 GAGTCAATTGTTAACATTTCAGG + Intronic
1143265905 17:5637415-5637437 GAGCTGATTATTAAATTTTTAGG + Intergenic
1143916062 17:10294132-10294154 GAGCCAATTATAAAATTTTCAGG - Intergenic
1144108939 17:12012884-12012906 GATCCACTTGTTAATTTTCTTGG + Intergenic
1145838481 17:27973204-27973226 GAGCTAATTGTTAAATTTTCAGG + Intergenic
1147449474 17:40495064-40495086 GAGCTGATTGTTAAATTTTCAGG + Intronic
1148174634 17:45552951-45552973 GAGCCAAGGGTTAAGACTTTAGG + Intergenic
1148274632 17:46292502-46292524 GAGCCAAGGGTTAAGACTTTAGG - Intronic
1148296736 17:46510076-46510098 GAGCCAAGGGTTAAGACTTTAGG - Intergenic
1149012588 17:51872682-51872704 GAGCCAATTGTTAAATTTTCAGG + Intronic
1149260397 17:54874199-54874221 GATCTAATTGCTATGTTTTTAGG - Intergenic
1149416461 17:56464962-56464984 GAGCCAACTGTTAAATATTCGGG + Intronic
1149670751 17:58407239-58407261 CAGCTAATTTTTAAATTTTTTGG + Intronic
1150101700 17:62429595-62429617 GAGGAAATTCTTAAGGTTTTTGG + Intronic
1150638087 17:66930642-66930664 CAGCTAATTTTTAATTTTTTTGG - Intergenic
1150926557 17:69538563-69538585 GAGGCAATTGTTTAGATTTTAGG + Intronic
1152967687 18:131648-131670 CTGCCAATTGTTACCTTTTTTGG - Intergenic
1153767411 18:8387531-8387553 GAGCCAATTGTTAAGTTTTCAGG + Intronic
1153974870 18:10260234-10260256 GAGCCGATTGTCAAATCTTTGGG + Intergenic
1153990191 18:10390218-10390240 GAGCCAATTGTTAAATATTGAGG + Intergenic
1154911086 18:20652056-20652078 ATGCCAATTGTTACCTTTTTTGG + Intergenic
1154926302 18:20940401-20940423 ATGCCAATTGTTACCTTTTTTGG + Intergenic
1155133697 18:22965768-22965790 GAACCAATTGTTGAGCCTTTTGG + Intronic
1155324174 18:24649552-24649574 GAGCCAAGTGTTCAATTTTTAGG + Intergenic
1156007350 18:32458661-32458683 GAGCCCTTTGTTCAATTTTTTGG - Intronic
1156179754 18:34589124-34589146 CAACCAATTTTTAAGTTTATTGG + Intronic
1158617583 18:59002285-59002307 GAGCCAATTGTTAAGTGTCAAGG + Intergenic
1158766160 18:60453185-60453207 TAGCCAATGGTTATGATTTTGGG + Intergenic
1158940229 18:62400841-62400863 GAGCCGATTGTAAAATTTTCAGG - Intergenic
1159985958 18:74841190-74841212 GGGCCAATTGTTAAACTTTAAGG + Intronic
1162294984 19:9807205-9807227 CAGCCAATTTTTATATTTTTAGG - Intergenic
1164614986 19:29662288-29662310 GGGCCAAATGTTAAGTACTTTGG - Intergenic
1165415636 19:35691754-35691776 CAGCTAATTTTTAAATTTTTTGG - Intergenic
1165499218 19:36174409-36174431 TGGCCAATTTTTAAATTTTTTGG + Intergenic
1166071155 19:40388884-40388906 CAGCCAATTTTTGTGTTTTTTGG - Intronic
1166208050 19:41285869-41285891 CAGCCAGTAGTTAAGTTTTTGGG - Intronic
1167017996 19:46854126-46854148 CAGCTAATTTTTAAATTTTTTGG + Intergenic
925267381 2:2575485-2575507 GAACCAACTGTTAAATTTTCAGG + Intergenic
925692886 2:6543133-6543155 GAGCCTATAGTTAAATTTTAAGG + Intergenic
926327609 2:11798638-11798660 GAGTCAATTCTTAATTTTTCAGG - Intronic
926548878 2:14276447-14276469 GATCCAGTTGTAAAATTTTTAGG - Intergenic
927171103 2:20370518-20370540 GAGCCAAATGTTAAATTTCCAGG + Intergenic
928263848 2:29792402-29792424 GGGCCACTAGTTAAGTTTTGGGG + Intronic
928943646 2:36752732-36752754 GAGCCAATTGTTATGCTTTCAGG - Intronic
928954377 2:36847919-36847941 GAGCCTATTTATATGTTTTTTGG + Exonic
929374665 2:41270883-41270905 GACCCAATTGTCAAATTTTCAGG + Intergenic
930310624 2:49735016-49735038 GAGCCTATTATTAAGTATTTGGG + Intergenic
932364400 2:71139297-71139319 TAGCGTATTGTTAAATTTTTTGG - Intronic
933082762 2:78013888-78013910 CAGCTAATTGTTAACATTTTTGG - Intergenic
933437387 2:82264876-82264898 GAGCCCTTTGTGAAGTTTTGTGG - Intergenic
933883944 2:86700260-86700282 CAGCTAATTTTTAAATTTTTTGG + Intronic
935424810 2:102908996-102909018 GACTCAAATGTTAATTTTTTTGG + Intergenic
935791303 2:106592590-106592612 GAGCCAGTTGTTAAATTTTCAGG + Intergenic
936826393 2:116586899-116586921 GAGCTGATTATTAAATTTTTAGG + Intergenic
937944275 2:127317687-127317709 GAGCGAATTGTTCAGTATTATGG - Exonic
938257730 2:129872954-129872976 GAATCCATTGTTAATTTTTTTGG + Intergenic
938402979 2:131008307-131008329 GATCCAATTGTTCTATTTTTAGG - Intronic
939032514 2:137093466-137093488 GAGCCAATTGTTAAATTTTCAGG - Intronic
940393484 2:153160829-153160851 GAGCCAAATTTCAAGTTATTAGG + Intergenic
941168449 2:162108807-162108829 CAGCCAATTGTTAAATTTTCAGG - Intergenic
942530741 2:176907188-176907210 GAGCTGATTGTTAAATTTGTAGG + Intergenic
943286049 2:186001711-186001733 GAGCCAAGTGTGAAATTTTCAGG + Intergenic
943529511 2:189061869-189061891 GAGCCAATTGTAAACTTATGGGG + Intronic
943911069 2:193568650-193568672 ATTCCAATTGTTAATTTTTTTGG + Intergenic
945132548 2:206589182-206589204 GAGCCAATTGTTAAATTTTCAGG + Intronic
945834123 2:214818990-214819012 GAGCCATTTATTAAATTTTCAGG + Intergenic
946592236 2:221263217-221263239 GATCCAATTGTTAAATTTGAAGG + Intergenic
948081507 2:235208746-235208768 GAGCCGATTGTTAGATTTTTAGG + Intergenic
1168927750 20:1596930-1596952 GAACCAACTGTTAAATTTTCAGG + Intronic
1169174866 20:3502194-3502216 CAGCCAATTTTTAAATTTTCAGG - Intronic
1169519294 20:6353763-6353785 GAGCCAATTGTTAAATTTTTAGG - Intergenic
1169535890 20:6540066-6540088 GAACCAAATGTTAAGTTCTATGG - Intergenic
1169541896 20:6608444-6608466 GGGCTAATTGTTAAATTTCTTGG + Intergenic
1170350161 20:15431179-15431201 GAACCAACTGCTAAGTTTTCAGG - Intronic
1170559275 20:17542163-17542185 GAGCCAATTGCTAAATTTTCAGG + Intronic
1170884135 20:20323779-20323801 AAACCAATTGTTAATTTTTTTGG + Intronic
1171202538 20:23253989-23254011 GAGCCAATTGTTAAACTGTCAGG - Intergenic
1172359081 20:34299774-34299796 GAATCAAATCTTAAGTTTTTGGG - Intronic
1172507126 20:35471383-35471405 GGCCCATTTGTTAACTTTTTGGG + Intronic
1172573626 20:35989625-35989647 GAGCTGATTGTTAAATTTTCAGG + Intronic
1172616011 20:36285102-36285124 GAGCCATTTGTTAAATATTCAGG - Intergenic
1172858478 20:38027486-38027508 CTGTCAATAGTTAAGTTTTTGGG - Intronic
1173048363 20:39534797-39534819 GAGCCTATTGTTAACTTTTCAGG + Intergenic
1173151139 20:40567448-40567470 GAGCCAATTGTTAAATTTTCAGG - Intergenic
1174010731 20:47447519-47447541 CAGCTAATTTTTAAATTTTTTGG - Intergenic
1174638757 20:52024825-52024847 CAGCTAATTTTTAAATTTTTTGG - Intergenic
1174829144 20:53797014-53797036 GAGCTGGTTGTTAAGTTTTCAGG - Intergenic
1174829909 20:53803134-53803156 GAGCCAACTGTTAAATTTTCAGG + Intergenic
1177196682 21:17910981-17911003 GAGCCAATTGTTAAGTTTTTAGG + Intronic
1177304904 21:19302189-19302211 GAGCCAATTTTAAAGTTTTAAGG + Intergenic
1177793664 21:25749171-25749193 GATACAATTTATAAGTTTTTAGG + Intronic
1178145370 21:29734063-29734085 GAGCCAACTGTTAAATTTTCAGG - Intronic
1178398535 21:32263912-32263934 GAGCCAATTATGAAATTTTCAGG - Intergenic
1178459428 21:32788874-32788896 GAGCTGATTGGTAAGTTTTCAGG + Intergenic
1178692881 21:34764223-34764245 CAGCCAATTGTTAAATTTTCAGG - Intergenic
1178821627 21:35980808-35980830 GAGCCAACCGTTAACTTTTCAGG - Intronic
1178899203 21:36585699-36585721 GAGCCAATTGTAAAATTTGCCGG - Intergenic
1179036792 21:37764992-37765014 GAGCCAATTGTTAAATTTTCAGG + Intronic
1179806755 21:43843694-43843716 TGGCCAATTTTTAAATTTTTGGG + Intergenic
1179913547 21:44462423-44462445 CAGCCAACTGTTAAGGTTTCAGG + Intergenic
1180234336 21:46448329-46448351 CAGCCAATTTATAAGTTTGTGGG + Intergenic
1182120042 22:27780434-27780456 GAGCCCATTGTTAAATATTCAGG + Intronic
1182453798 22:30436591-30436613 CAGCCAATTGTTAGCTTTTCAGG + Intergenic
1182843665 22:33413006-33413028 AAGCCTATTGTTAAATTTTTAGG - Intronic
1182855053 22:33509611-33509633 CAGCTAATTTTTAAATTTTTTGG + Intronic
1183954972 22:41374242-41374264 TAGCTAATTTTTAATTTTTTTGG - Intronic
949427131 3:3929638-3929660 GAGCCACATGGTAAGATTTTAGG + Intronic
949796113 3:7852845-7852867 GAGCAGATTGTTAAATTTTGAGG + Intergenic
950778355 3:15369785-15369807 CAGCCAATTATTAAATTTTCAGG + Intergenic
951237893 3:20256121-20256143 GATCCTATTGTGAAGTTTTTGGG + Intergenic
951651693 3:24958052-24958074 GAGCCAGATGTTAAATTTTTAGG - Intergenic
952236244 3:31483013-31483035 AAGCCAATTGTTAAATTTTTAGG + Intergenic
952360977 3:32629591-32629613 ACCCCAATTGTTAAGTTTTTGGG - Intergenic
952464073 3:33562497-33562519 GAGTCAATTGTTAAATATTCAGG + Intronic
953720256 3:45349045-45349067 GAGCCAATTGTTAACTGTTTGGG + Intergenic
954083710 3:48227634-48227656 GAGCCAATTGTTAAATTTTCAGG + Intergenic
954218374 3:49137102-49137124 GAGCCAATTGTTAAATTTTCAGG + Intergenic
955143571 3:56293496-56293518 GAGCCATTTGTTAAATTCTCAGG - Intronic
955414879 3:58682944-58682966 GAGCCAATTGTTAAATTTTTGGG - Intergenic
955848838 3:63197090-63197112 CAGCCAATTTTAAATTTTTTAGG + Intergenic
955943972 3:64173542-64173564 GAGCCAATTGGTCAGTTTTCAGG - Intronic
956724274 3:72144432-72144454 GAGCCAATTGTTAAGTATTTAGG - Intergenic
956820051 3:72946112-72946134 TAGCTAATTTTTAAATTTTTTGG - Intronic
957304513 3:78440344-78440366 CAGCCACATGTTAAGTGTTTAGG - Intergenic
960113183 3:113865447-113865469 AAGCCAACTGTTAGGATTTTTGG + Intronic
960231520 3:115233291-115233313 GAGCAGATTGTTAAATTTTCAGG + Intergenic
960264809 3:115608403-115608425 GAGCCAATTGTTAAGTTTTCAGG + Intergenic
960559396 3:119066548-119066570 GAGCCAATTGTTAAATATTCAGG + Intronic
961115627 3:124326775-124326797 GAGACAGTTGTTAAATTTTTAGG + Intronic
961909224 3:130297642-130297664 CAACCAAATATTAAGTTTTTAGG + Intergenic
962707235 3:138056050-138056072 GATCCTATTTTTAACTTTTTTGG - Intergenic
963136453 3:141909724-141909746 GAACCCATTGTTAAGTTCTTTGG + Intronic
963444199 3:145382609-145382631 GAGACAATTGTTGAAGTTTTAGG + Intergenic
963976945 3:151491246-151491268 GAGCAAATTGATAAATTTCTAGG + Intergenic
964253149 3:154743569-154743591 GAGCCAATTGTTTGCTTTTTAGG + Intergenic
965137555 3:164791265-164791287 GAAACAATTGTTAAGTGATTGGG + Intergenic
965548223 3:169937123-169937145 GAGCCAATTATTCAATGTTTAGG - Intronic
966476661 3:180356529-180356551 GAACCAATTGTTAAGTATTCAGG + Intergenic
967609977 3:191492797-191492819 GAGCCAATTTTTAAATATTCAGG - Intergenic
967654672 3:192032715-192032737 GACCCAATAGTTAAGATTTAAGG - Intergenic
968051858 3:195659937-195659959 GTGCCAATTATTAATTTTTTAGG - Intergenic
968103956 3:195988398-195988420 GTGCCAATTATTAATTTTTTAGG + Intergenic
968302259 3:197625988-197626010 GTGCCAATTATTAATTTTTTAGG + Intergenic
969318633 4:6396894-6396916 GAGTCAATAGTTACATTTTTAGG - Intronic
969318644 4:6396995-6397017 GAGTCAATAGTTACATTTTTAGG - Intronic
971213559 4:24642645-24642667 CAGCCAATTGTTAAATTGTCAGG + Intergenic
971365599 4:25974476-25974498 CAGCTAATTTTTAATTTTTTTGG + Intergenic
971996619 4:33973641-33973663 GAGACATTTGTAAAGTTTATTGG + Intergenic
972432371 4:38995343-38995365 GAGCAAATGGTGAAGTTTTTAGG - Intronic
974179960 4:58371792-58371814 GAGCAATTTTTTATGTTTTTTGG + Intergenic
974613897 4:64255640-64255662 TTGCCAATTGATAAATTTTTAGG - Intergenic
974865437 4:67575166-67575188 AAGCCAATTGTTAAATTTTCAGG - Intronic
974941160 4:68469937-68469959 GAGCAAATTGGAAAGTTATTGGG - Intronic
976110100 4:81663595-81663617 GAGCCAACTGTTAAATTTTCAGG + Intronic
976286807 4:83378485-83378507 GATCCCAGGGTTAAGTTTTTGGG - Intergenic
976430799 4:84962165-84962187 GAGCCCATTGTTAAATTTTCAGG + Intronic
976495875 4:85728767-85728789 TGGCCAATTTTTGAGTTTTTGGG + Intronic
976586321 4:86800929-86800951 GAGCTAAATGTTAACCTTTTAGG + Intronic
976748921 4:88434105-88434127 GAGCCAATTGGTAAAGTTTCTGG - Intronic
977418383 4:96764274-96764296 GAGCCAATTCTGAAGTTCCTGGG + Intergenic
977512986 4:97984860-97984882 GACCCAATTGTTAAGTTTCCAGG - Intronic
977609808 4:99020208-99020230 GAGCAAATTGACCAGTTTTTAGG - Intronic
978393887 4:108257184-108257206 GAGCTGATTGTTAAGTTTTCAGG + Intergenic
978439812 4:108721742-108721764 CTGCCAATTGGTCAGTTTTTTGG + Intergenic
978541502 4:109820994-109821016 GGGCTTATTGTTTAGTTTTTTGG + Intronic
978744969 4:112182657-112182679 GAGCAAGTTGTTAAATTTTCAGG + Intronic
978793263 4:112684540-112684562 CAGCTAATTTTTAAATTTTTTGG - Intergenic
979358790 4:119736786-119736808 GAGCCAATTGCTAAACTTTCTGG - Intergenic
979943965 4:126801379-126801401 GATCCAATTGTAGAGTTCTTAGG - Intergenic
980194080 4:129565473-129565495 GAGCCAGTTGTTAAATTTCCGGG + Intergenic
981416932 4:144504482-144504504 CAGCTAATTGTTAATATTTTTGG + Intergenic
981569482 4:146136308-146136330 CAGCCAATTGTTACATGTTTAGG + Intergenic
981771339 4:148312132-148312154 AAGCCAATTCTTAACTTTTCAGG + Intronic
981783930 4:148456507-148456529 GAGCCACATGTTAAGTTTGCAGG + Intergenic
981917881 4:150054382-150054404 GAACCAGTTGTTAAATTTTCAGG + Intergenic
982220374 4:153119527-153119549 GAACCAACTGTTAAATATTTAGG + Intergenic
982510930 4:156282372-156282394 AAGCCCATTGTTTAGCTTTTGGG + Intergenic
982612440 4:157592928-157592950 GAGCCAATTGTAAATCTTTTAGG + Intergenic
982633228 4:157859335-157859357 AAGCCTATTGTAAAATTTTTTGG + Intergenic
982877852 4:160670729-160670751 GAACCAATGGTTAAATTTTCAGG + Intergenic
985020978 4:185690036-185690058 GACACAGTTGTTAAGTTATTTGG + Intronic
986769677 5:10960936-10960958 GAGCTGATTGTTAAATTTTCAGG + Intergenic
986835550 5:11633278-11633300 AAGTCAATTGTTAATTTTGTTGG - Intronic
987223750 5:15818379-15818401 AAGCCCATTTCTAAGTTTTTTGG + Intronic
987943393 5:24571872-24571894 GAGCCTATTGTTAATTTTTTAGG - Intronic
988470994 5:31538326-31538348 CATCCAATTGTAAAGGTTTTTGG - Exonic
989152015 5:38309005-38309027 GAGCCAATTGTTAAATTTTCAGG + Intronic
989156091 5:38346425-38346447 GAGCAAATTGTGAACTTTTCAGG + Intronic
989416549 5:41184181-41184203 GAGTCAACTGTTAACTTTTCAGG - Intronic
989663063 5:43820656-43820678 GAGCCAATAGTTAAATCTTCAGG - Intergenic
990364585 5:55057305-55057327 GAGCCAACTGTTAAATTTTTAGG - Intergenic
992474383 5:77087895-77087917 GAGCTAATTGTTAAATTTCCAGG - Intergenic
993028364 5:82672868-82672890 GAGCCGATTGTCAAATTTTTAGG - Intergenic
993643148 5:90430439-90430461 GAGCCAATTGTTAAAACTTCAGG + Intergenic
994194406 5:96906427-96906449 CAACCAATTTTTAAATTTTTTGG + Intronic
995149962 5:108831110-108831132 GACCCAATTGTGTGGTTTTTTGG + Intronic
995879120 5:116823943-116823965 TTGCCAGTTGTAAAGTTTTTTGG + Intergenic
995938422 5:117547699-117547721 GAGCCAATTGTTAAGTATTTAGG - Intergenic
996546923 5:124689581-124689603 GAGCTGACTGTTAAGGTTTTTGG - Intronic
996564180 5:124862594-124862616 CAGCCAATTTTTAAGTTTTTTGG - Intergenic
996601932 5:125274253-125274275 GAGACAATTGTTAAAGTTTCAGG - Intergenic
996780213 5:127177694-127177716 GCGCCAATTGTTAAATTTTCAGG - Intergenic
997040873 5:130252227-130252249 GAGCCAACTGTTGAATTTTCAGG + Intergenic
997116616 5:131132175-131132197 TAGCCAATTGTTAAATTTTCAGG + Intergenic
997363569 5:133311147-133311169 GAGCTCATTGTTAAATTTTCAGG - Intronic
998454771 5:142263299-142263321 GAGCTCAGTGTTAAGTTTTCAGG - Intergenic
999145866 5:149393353-149393375 GAGCCAATTGCTAATTTGTACGG - Intronic
1000005857 5:157184358-157184380 TAGCTAATTGTTAAGTTTTCAGG - Intronic
1000131648 5:158305953-158305975 GAGCCAATAGTTAAACTGTTAGG + Intergenic
1001787938 5:174430069-174430091 GAGCCAATTATTAAATTGTCAGG - Intergenic
1003274292 6:4636262-4636284 GAGCCAACTGTGAAATTTTCAGG - Intergenic
1004254940 6:14054819-14054841 GAGCTGATTGTTAAATTTTCAGG - Intergenic
1005350511 6:24930339-24930361 AAGCCAAGTCTTAACTTTTTAGG - Intronic
1006784856 6:36659481-36659503 CAGGCAATTGTTAAATATTTGGG - Intergenic
1008375542 6:50787130-50787152 GAGCCTATTGTCAAGTTTCCTGG + Intergenic
1009244561 6:61220264-61220286 CTGCCAATTCTCAAGTTTTTAGG + Intergenic
1010539190 6:77069957-77069979 GAGCCAAATGTTAATTTTCAAGG - Intergenic
1010875134 6:81094038-81094060 GAACTAATGGTTAAATTTTTAGG - Intergenic
1012488420 6:99748563-99748585 AGGCCATTAGTTAAGTTTTTGGG - Intergenic
1012890733 6:104894359-104894381 GTGTCAATTGTTAAATTTTCAGG - Intergenic
1013978686 6:116104491-116104513 AAGCCAATTGTTAACTATTCAGG + Intronic
1014327939 6:120022932-120022954 TAACCAACTGTTAAGGTTTTGGG + Intergenic
1014382821 6:120764880-120764902 GAGCCAGTAGTTAAATTTTCAGG - Intergenic
1014570547 6:123002335-123002357 GAGCAAACTGACAAGTTTTTTGG - Intronic
1014641630 6:123917905-123917927 GAGCTAATTGTTAAAATTTTAGG + Intronic
1015219090 6:130783440-130783462 GAGCCAATTGATAAAATGTTTGG - Intergenic
1015593032 6:134840550-134840572 GAGCAAATTACTACGTTTTTAGG + Intergenic
1015796772 6:137020514-137020536 GAGCCATTTATTAAATTATTGGG - Intronic
1017049071 6:150373572-150373594 GAGCCAACTGTTAAATATTTAGG + Intronic
1020058207 7:5133184-5133206 CAGCTAATTTTTAAATTTTTTGG + Intergenic
1020169365 7:5833141-5833163 CAGCTAATTTTTAAATTTTTTGG - Intergenic
1020525963 7:9259339-9259361 GAGCCAATTGTTACATTTTCAGG + Intergenic
1022580724 7:31550875-31550897 GAGAAAATTGTTAAAATTTTAGG - Intronic
1023503253 7:40873208-40873230 AAGCTCATTGGTAAGTTTTTTGG - Intergenic
1023638098 7:42233257-42233279 GATCCTTTTCTTAAGTTTTTAGG - Intronic
1023802559 7:43847595-43847617 GAGGAAATTGTTAAGTTTTAAGG + Intergenic
1024629995 7:51238938-51238960 GAGCCAACTGTTAAATCTTCTGG + Intronic
1026540258 7:71274197-71274219 GAGCCTACTGTTAAATATTTAGG - Intronic
1026963123 7:74422473-74422495 CAGCTAATTTTTAAATTTTTTGG + Intergenic
1027244165 7:76354820-76354842 GAGCAAATCGTTAACTCTTTGGG - Intronic
1027568969 7:79838221-79838243 GAGATTTTTGTTAAGTTTTTTGG - Intergenic
1028140564 7:87270061-87270083 GAGCCAGTTGTTAATTTTTCAGG + Intergenic
1030396008 7:108987883-108987905 GAGCCAATTGTTAAGTTTTCAGG - Intergenic
1030906798 7:115195127-115195149 GAGCTGATTGTTAAATTTTCAGG + Intergenic
1031587348 7:123548242-123548264 GATACAACTGTTAAGTGTTTGGG + Intronic
1032030844 7:128482458-128482480 GAGGAAATTCTTAAGGTTTTTGG + Intronic
1032326115 7:130929828-130929850 GAGCCAATTCTTAAGTTGGATGG + Intergenic
1033889866 7:145998552-145998574 GAGCCAATTGTTAAATATTCAGG + Intergenic
1034025429 7:147698320-147698342 GAGGCAACTGTTAAATTTTCAGG - Intronic
1034124410 7:148658013-148658035 AAGCTAATTGTTAAGATTTCAGG - Intergenic
1035611644 8:969501-969523 GAACCAACTGTTAAGTTTTTAGG + Intergenic
1036567063 8:9946726-9946748 CAGCTAATTTTTAATTTTTTTGG + Intergenic
1036929153 8:12936346-12936368 CAGCTAATTTTTAAATTTTTTGG + Intergenic
1038028680 8:23617047-23617069 CAGCTAATTGCTAAGTTTTCAGG - Intergenic
1038376518 8:27045381-27045403 GAGCCAACTGTTAAGTTTTCAGG + Intergenic
1038879655 8:31594254-31594276 GAGTAAATTGGTAAGTGTTTTGG - Intergenic
1039605983 8:38881133-38881155 GAACCAATTGTTATATTCTTTGG - Intergenic
1039815899 8:41094201-41094223 GACCCAGTTGTTAAATTTTCAGG - Intergenic
1041488551 8:58406581-58406603 GAGCCTACTGTTAAATTTTTAGG - Intergenic
1041825469 8:62091150-62091172 GGGCCCAGTGTAAAGTTTTTTGG + Intergenic
1042961460 8:74308104-74308126 GAGCTTATTATTAATTTTTTTGG - Intronic
1043035186 8:75188754-75188776 GAGCCAGATGTTAAGTTTTATGG + Intergenic
1043804327 8:84652244-84652266 GAGATAATTTCTAAGTTTTTAGG - Intronic
1045025313 8:98081266-98081288 CAGCTAATTTTTAAATTTTTTGG + Intronic
1045415543 8:101963097-101963119 AAGCCAATTGTTAAATTTTCAGG - Intronic
1045663466 8:104461977-104461999 GAGCCAAATGTTAAAATTATAGG + Intronic
1045680143 8:104650312-104650334 GAACCAATTGTTAAATTTTTAGG + Intronic
1047045179 8:121045142-121045164 GAGTCAATGGTTAATTTTTCAGG + Intergenic
1047799063 8:128289922-128289944 GAGCCAATTGTTACATGGTTAGG + Intergenic
1048478456 8:134765105-134765127 GGGCCAACTGTTAAATTTTCAGG + Intergenic
1048514114 8:135090194-135090216 GATTCAATTGTTAAATTTCTAGG - Intergenic
1048521703 8:135161395-135161417 TAGCCCATTTTTATGTTTTTGGG + Intergenic
1051384097 9:16488162-16488184 AAGGCCATTGTTAAGGTTTTTGG - Intronic
1051758105 9:20427764-20427786 GAGCCAGCTGTTAAATTTTTAGG + Intronic
1053026391 9:34732144-34732166 GAGCCTATTTTTAGTTTTTTTGG + Intergenic
1053471817 9:38352058-38352080 GAGCCCATTCTTCAGTTCTTTGG + Intergenic
1055018760 9:71646835-71646857 GAGCCCACTGTTAAATATTTAGG - Intergenic
1055232456 9:74082462-74082484 AAGCCATTTGTTTAGTTTTCAGG + Intergenic
1055383072 9:75730218-75730240 AAGCCAATTGTTAATTTTTCAGG + Intergenic
1055444451 9:76368663-76368685 AAGCCAATTGTTAAGTTTTCAGG - Intergenic
1057832208 9:98416160-98416182 GAGCCAGTTGTTAAATTATCAGG - Intronic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1058238408 9:102523374-102523396 GTCCCATTTGTTAATTTTTTGGG + Intergenic
1058760970 9:108131954-108131976 GAGCCAATAGCTGAATTTTTAGG + Intergenic
1059029352 9:110674410-110674432 GAGCCACTTGGTAATTTTTTAGG - Intronic
1059731320 9:117059956-117059978 GATCCAATTGTTAAATATTTAGG + Intronic
1060138451 9:121181578-121181600 GAGGCAATTGATAACTTTATTGG + Intronic
1060604112 9:124899031-124899053 CAGCTAATTTTTAAATTTTTTGG - Intronic
1061103354 9:128509794-128509816 TAGCCAATTTTTAAGTATTTTGG - Intronic
1061369166 9:130188133-130188155 GTGGCAATTGTTAACATTTTGGG + Intronic
1185556525 X:1025764-1025786 GAGCCAATTTTTATTATTTTTGG - Intergenic
1185923231 X:4117690-4117712 GAGCAAATTGTTTAGCATTTTGG - Intergenic
1186050006 X:5581854-5581876 GAGCCTATTTTTAATTTTTGAGG - Intergenic
1186404361 X:9288973-9288995 GAGCCCATTGTTCACTATTTTGG - Intergenic
1187174749 X:16886166-16886188 GAGCTCATTGTGAAGTTTTCAGG - Intergenic
1187302535 X:18064984-18065006 GAGCCATCTGCTAGGTTTTTTGG + Intergenic
1187303205 X:18071800-18071822 AAGCCAATTGGGAAGTTATTTGG - Intergenic
1187833758 X:23409661-23409683 GAACCAATTGTTACATTTTCAGG - Intergenic
1188223590 X:27570301-27570323 CATCCTATTTTTAAGTTTTTAGG - Intergenic
1188489974 X:30727166-30727188 GAGCCTATGGATAACTTTTTGGG - Intronic
1192544227 X:71999420-71999442 GAATCAATTGTTAAATATTTAGG + Intergenic
1194621663 X:96180626-96180648 GAGATAATGGTTAAGTTTGTGGG - Intergenic
1194639392 X:96384564-96384586 GAGCCAATTATTAAATTTTCAGG + Intergenic
1195460075 X:105114655-105114677 TAGCCATTAGTAAAGTTTTTGGG - Intronic
1196501326 X:116386489-116386511 GAGCTATTAGTTAAGTTTATTGG - Intergenic
1197834156 X:130676941-130676963 GACCCAACTGTTAAGCCTTTTGG + Intronic
1198411065 X:136368880-136368902 GAACCAATTGTTAAATTTTCAGG - Intronic
1199231339 X:145439056-145439078 GAGCCAATTGTTAAACATTCAGG + Intergenic
1199703983 X:150408048-150408070 AAGCCAACTGTTATGTTTTCAGG + Intronic
1201227226 Y:11830037-11830059 GAAACAATTGTTAAATTTTTAGG - Intergenic
1201666514 Y:16462981-16463003 GAGTCAAATGTTAATTTTGTTGG - Intergenic
1202370712 Y:24193661-24193683 GAGCCAACTGTTGAATTTTCAGG + Intergenic
1202500072 Y:25476456-25476478 GAGCCAACTGTTGAATTTTCAGG - Intergenic