ID: 1177198579

View in Genome Browser
Species Human (GRCh38)
Location 21:17929546-17929568
Sequence GCAGCCTGCTGAGCTGGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 3, 2: 14, 3: 52, 4: 429}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177198579 Original CRISPR GCAGCCTGCTGAGCTGGGAT TGG Intronic
900370723 1:2331040-2331062 GCCGCCTGCTGCCCTGGGAGGGG - Intronic
900385767 1:2409931-2409953 GCTACATGCTGAGCTGGGGTTGG + Intronic
901153758 1:7122031-7122053 CCGGCCTGCAGAGCAGGGATGGG + Intronic
901802416 1:11715979-11716001 GCTACCTGCAGGGCTGGGATGGG - Intronic
902598046 1:17522348-17522370 ACAGCCTGGGGAGCTGGGAAGGG + Intergenic
903169832 1:21545737-21545759 GCAGCCTCCTGAGCCGGAGTAGG - Intronic
903188073 1:21640584-21640606 GCAGGCAGCTGGGCTGGGAAAGG + Intronic
903381561 1:22900569-22900591 CCATTCTGCTGAGCTGGAATGGG + Intronic
903884833 1:26535157-26535179 GCAGCCTGGGGAGAAGGGATGGG - Intronic
903959416 1:27047385-27047407 CTTGCCTGCTGAGTTGGGATGGG - Intergenic
904202913 1:28833274-28833296 GCAGTCTCCTGAGCTGGAAAAGG - Intronic
904294017 1:29506032-29506054 GCAGACAGCAGAGCTGGGACTGG - Intergenic
904324978 1:29722407-29722429 GTAGCCTGAGGATCTGGGATCGG + Intergenic
905229856 1:36508195-36508217 GCAGCCTGGTGGGGTGGGAGTGG + Intergenic
905771603 1:40641694-40641716 GCAGCCTGGTGAGGGGGCATGGG - Exonic
906662195 1:47590812-47590834 GCAGCCTGCTGGGCAGGGCAGGG + Intergenic
906835017 1:49073971-49073993 GCACCTTGCTGAGCTGTGGTGGG + Intronic
907419989 1:54340789-54340811 GCAGCCCTCTGGGCTGGTATGGG - Intronic
907548668 1:55285576-55285598 GCAGCCTGTAGAGCTGGAAGTGG + Intergenic
907994943 1:59620810-59620832 ACAGCGTGAAGAGCTGGGATAGG - Intronic
912495029 1:110086011-110086033 GCAGCCTTCTGGGCTGGGGCAGG + Intergenic
913193031 1:116429716-116429738 GCAGCCAGCTGCGGTGGGACAGG + Intergenic
919043574 1:192424049-192424071 GCAGTCAGCTCAGCTGGGATGGG + Intergenic
919188796 1:194189098-194189120 GGAGGCTGCTGAGATGGGAAAGG + Intergenic
919478519 1:198057126-198057148 GCAGCCTGCTTGGCCAGGATTGG - Intergenic
919785148 1:201254044-201254066 GCTGCCTGCAGGGCTGGGCTGGG - Intergenic
919848982 1:201659787-201659809 ACAGCCGGCTGCGCTGGGGTAGG + Intronic
919994017 1:202730943-202730965 TCAGTCTGCTGAGCAGGGCTTGG + Exonic
920084618 1:203406236-203406258 GCAGGAGGCTGAGCGGGGATGGG - Intergenic
920311306 1:205050091-205050113 ACAGCTTCGTGAGCTGGGATAGG - Intronic
920441879 1:205986153-205986175 TGAGCCTGCTTAGCTGGGCTGGG - Intronic
920504631 1:206507470-206507492 GCAGCCTGCTGGGCGGGGCGGGG - Intergenic
920852100 1:209634843-209634865 GAAGCCTGGTGAGCTGAGCTAGG - Intronic
921045772 1:211476990-211477012 GCAGACTGCTCAGCTGGTAGGGG - Exonic
921471751 1:215557711-215557733 GTAGCCTGCTTAGCTGGGATTGG - Intergenic
922396501 1:225206967-225206989 GGATCCTGTTGATCTGGGATGGG + Intronic
922516097 1:226209390-226209412 GGACCCTCCTGTGCTGGGATTGG - Intergenic
922800420 1:228362415-228362437 GCAGCCTCCTGAGAGGGGAGTGG + Intronic
923427073 1:233881743-233881765 GCAGAATGGTGAGCTGGGCTTGG + Intergenic
924068907 1:240255163-240255185 GCAGTCTGCTCAGCCAGGATCGG - Intronic
1064030062 10:11877832-11877854 GCTGCCCCCTGAGCTGGGGTCGG - Intergenic
1065390266 10:25175456-25175478 CCTGCTTGCTCAGCTGGGATTGG + Exonic
1065912885 10:30324866-30324888 TCAGCCTTCCGAGCTGGGACAGG - Intronic
1067430408 10:46239879-46239901 GCAGCAAGCTTGGCTGGGATTGG + Intergenic
1068648067 10:59492073-59492095 GCAGCCTGCCCAGCAAGGATTGG + Intergenic
1069738113 10:70670696-70670718 GCAGCCTGCTTCGCTGGAGTGGG - Intergenic
1069949403 10:72008697-72008719 GCAGCCTCCTGAGCAGGCCTAGG + Exonic
1070896392 10:79986143-79986165 GGAGGCTGCTTATCTGGGATGGG + Intergenic
1071225711 10:83526221-83526243 GCAGCCAGCTGGGCCAGGATTGG + Intergenic
1071248664 10:83792044-83792066 GCAGGCTGCTGGCCTGGGACTGG - Intergenic
1071759315 10:88583006-88583028 GCAGGCTGCTGAGGTGGTGTGGG - Intronic
1072314463 10:94188559-94188581 GCAGCCTGCATAGCTTGGTTTGG + Intronic
1072349859 10:94545984-94546006 GCAGCCTGCGGGGCTGAGGTGGG + Intronic
1072661093 10:97363971-97363993 GCAGCCTGGTGAGCCAGGAGGGG - Intronic
1072674108 10:97452792-97452814 GCATCCTGCTGAGGTGGAAAGGG - Intronic
1073350445 10:102815869-102815891 GCAACCTGCGGAGCTGGGCTTGG + Exonic
1073639120 10:105231088-105231110 GCAGCCTGCTTGGCCAGGATCGG - Intronic
1075179477 10:120196905-120196927 GCAGCTGGCTCAGCTGGGATTGG - Intergenic
1075260946 10:120963484-120963506 GCAGCCTTCTGACCTGGGCTGGG - Intergenic
1075469273 10:122675928-122675950 CCAGCCTGCTGGGCAGGGAAAGG + Intergenic
1075662666 10:124209009-124209031 TCACCCTGCTGAGTTGGGATAGG + Intergenic
1075861392 10:125679646-125679668 GCAGCCTGCCTGGCCGGGATCGG - Intronic
1076354010 10:129839436-129839458 GCAGCCTGCACAGCTCAGATGGG + Intronic
1076366082 10:129921871-129921893 GCTGGCTAGTGAGCTGGGATGGG - Intronic
1076564827 10:131391095-131391117 GCAACCTGTTGTGCTGCGATAGG - Intergenic
1077466100 11:2734441-2734463 GCAGCCAGCTGTGCTGGGCAAGG + Intronic
1077980986 11:7300736-7300758 GCAGCCTGATTACCTGGGACAGG + Intronic
1078190382 11:9089273-9089295 GGAGCCTCCTGAGCTGGTAGGGG + Intronic
1078329993 11:10411213-10411235 GCTGGCTGCTGAGCTGGGGAAGG + Intronic
1078760230 11:14245688-14245710 GCAGCCAGCTGGGCTGCGCTGGG - Intronic
1079098184 11:17524453-17524475 CCTGTCTGCTGAGGTGGGATTGG - Exonic
1079567713 11:21903099-21903121 GCATCCTGCTGAGCTGGTACAGG - Intergenic
1081760326 11:45572396-45572418 GGAGAGTGCTGAGCTGGGATGGG - Intergenic
1081761202 11:45577440-45577462 GAGGCCTCCAGAGCTGGGATAGG - Intergenic
1082046306 11:47731628-47731650 GCAGACTGCTGTCCTGGGACAGG - Intronic
1082809125 11:57467994-57468016 GCAGGCTGCTGAGCTGGCAGCGG - Exonic
1083862131 11:65426705-65426727 GCAGACTGCTGAGTGGGGATGGG + Intergenic
1084145587 11:67263529-67263551 GCTGCCAGCTGAGCAGAGATGGG + Intergenic
1084494486 11:69496038-69496060 GCAGCAAGCTCAGCTGGGTTTGG + Intergenic
1085046904 11:73358976-73358998 GCAGCCTGCTGAGGAGGGGAGGG - Intronic
1087304393 11:96472206-96472228 GCAGCCAGCTCATCTGGGATTGG + Intronic
1087353144 11:97059669-97059691 GCAGCCTGCTTGGCTGAAATTGG + Intergenic
1088797370 11:113274828-113274850 GCAGCCTGCTGGGCTGGGCTGGG - Intronic
1088993217 11:114972654-114972676 GCAGCTTGCTGAGAAGGGAATGG - Intergenic
1089321190 11:117627756-117627778 GAATGCGGCTGAGCTGGGATGGG + Intronic
1089356986 11:117860337-117860359 TCAGCCTGCTGGACTGGGATGGG - Intronic
1089606343 11:119643734-119643756 CAAGCCTGCGGAGCTGGGAGCGG - Intronic
1089944957 11:122461401-122461423 GCAGCCTGCTTGGCCAGGATTGG + Intergenic
1091882427 12:3990582-3990604 ACAGCCGGCTGGGCTGGGAAGGG + Intergenic
1091912137 12:4241073-4241095 GCAGTCTGCTTGGCCGGGATCGG - Intergenic
1093244901 12:16724206-16724228 GAGGCCTTCTGAGCTGAGATAGG + Intergenic
1093466779 12:19457495-19457517 GGAGGCTGCTGAGATGGGAAAGG - Intronic
1094473894 12:30826762-30826784 GGACCATGATGAGCTGGGATAGG - Intergenic
1095137976 12:38629512-38629534 GCAGCCTCCTGAGCTAGAGTAGG + Intergenic
1095339347 12:41070058-41070080 GGTGTCTTCTGAGCTGGGATGGG - Exonic
1096022870 12:48336871-48336893 GCAGACTGCTGAGCAGGGCCAGG - Intergenic
1096809797 12:54161995-54162017 CCAGCCTGCGGTGGTGGGATTGG - Intergenic
1097145941 12:56939384-56939406 GCAGCCTCCTAAGCTGGGGAGGG - Intergenic
1097903380 12:64895754-64895776 GCAGCCTTCTGAGCCAGAATAGG - Intergenic
1098293741 12:68983259-68983281 GCAGCCTCCTGAGCCAGAATAGG - Intergenic
1098394693 12:70005618-70005640 GCAGCCTGCTAGGCTAGAATTGG + Intergenic
1099519514 12:83642781-83642803 GCAGCATGCTAGGCTGGGATAGG - Intergenic
1099537200 12:83858649-83858671 GAAGCCTGCTCTGCTGGGATTGG - Intergenic
1102574173 12:113845344-113845366 CCAGGCTGCTGAGCTGGGGGTGG - Intronic
1102957310 12:117067212-117067234 ACAGCCTGCTGAGCTAGGTAGGG + Intronic
1103737627 12:123070577-123070599 GCAGCCAGTGGAGCTGGGAGGGG - Intronic
1103739294 12:123080634-123080656 GCTGACTGCTTACCTGGGATGGG - Intronic
1104783553 12:131435534-131435556 GCAGAATGCTTTGCTGGGATTGG + Intergenic
1104860147 12:131919360-131919382 TCAGCCTGCTGAGCCGAGAATGG + Exonic
1105063095 12:133172168-133172190 GCAGCCTGCAGGGCTGCAATTGG + Intronic
1105362268 13:19731470-19731492 GCAGTGAGCTGAGCTGAGATTGG - Intronic
1106276579 13:28214645-28214667 GGAGGCTGCTGAGATGGGAAAGG + Intronic
1107286885 13:38802936-38802958 GCAACCTGCTCAGCTGGGATTGG - Intronic
1108596725 13:51955928-51955950 GCAGGCAGCAGAGCTGGGATTGG - Intronic
1109155801 13:58907089-58907111 GCAGCTTGCTTGGCTAGGATTGG - Intergenic
1109808230 13:67471585-67471607 GCAACTTGCCTAGCTGGGATTGG - Intergenic
1110999715 13:82164537-82164559 GCAGGCTGCCGAGCTAGGAGTGG - Intergenic
1111433741 13:88179327-88179349 GCAGCCTCCTGAGCTAGAGTAGG - Intergenic
1112079927 13:95958789-95958811 GCAGACTGCTAGGCTGGGATTGG + Intronic
1112152972 13:96784319-96784341 GCAGCCTGCTCATCAGGAATTGG + Intronic
1115779043 14:36749202-36749224 GCAGCCTCCTGAGCCAGGGTAGG - Intronic
1116000164 14:39234520-39234542 GCAGCCTTCTGAGCCAGAATAGG - Intronic
1117509057 14:56430381-56430403 GCAGCTTGCTGAGGTGAGAAAGG - Intergenic
1117696023 14:58363573-58363595 GCCTCCTGAGGAGCTGGGATAGG - Intronic
1117745104 14:58861111-58861133 GCAGCCTGCTCAGCCAAGATTGG - Intergenic
1118300878 14:64614902-64614924 TGAGCCTGCTGGGCTGGGACCGG - Intergenic
1118839658 14:69500970-69500992 GCAGCCTGCAGATCCAGGATGGG + Intronic
1119171394 14:72538821-72538843 GCAGCCAGCTGAGCTGACAAGGG + Intronic
1119906738 14:78311438-78311460 GCAGCCTGCAGACCTGGGGTTGG - Intronic
1121716356 14:96078791-96078813 GCGGCCTCCTGAGCTGGGGCGGG - Intronic
1122265575 14:100545133-100545155 ACAGCCTGCTGAGCAGGGTGGGG + Intronic
1122718972 14:103711775-103711797 GCAGCCTGCTGAGGCCGGAGGGG - Exonic
1122881473 14:104692377-104692399 GCACCGTGCTGAGCGGGGCTGGG - Intronic
1122982041 14:105196379-105196401 GAAGGCTGCAGAGCTGGGAGGGG + Intergenic
1124345253 15:28917978-28918000 GCAGGCAGCTGAGCTGGGGTAGG - Intronic
1124604320 15:31159773-31159795 GCAGCCTGGTGAGCTGGGTATGG + Intronic
1125177886 15:36846163-36846185 GCAGCCTTCTGAGCAAGGATAGG + Intergenic
1125768894 15:42152392-42152414 GCAGTCAGCTGGGCTGGGCTTGG - Intronic
1126480117 15:49110202-49110224 GCAGCCTGCTCAGCCAGGATTGG + Intronic
1126866091 15:52938366-52938388 GGAGGCTGCTGAGATGGGAAAGG - Intergenic
1128109298 15:65066835-65066857 ACAGCCAGCTGAGCTTGGGTTGG + Intronic
1128740624 15:70081392-70081414 GCAGCTGGCTGACCTGGGCTGGG + Intronic
1128750373 15:70144360-70144382 CCATCCTGCTGAGCTGGGTTTGG - Intergenic
1129453563 15:75664108-75664130 GCAGCCTGGTGCGGTGGGAAGGG - Intergenic
1130015194 15:80180740-80180762 GCAGCCTCCAGAGCAGGGAGGGG + Intronic
1130448250 15:84024722-84024744 CCTGCCAGCAGAGCTGGGATTGG - Intronic
1132372638 15:101309036-101309058 CCATCCTGCTGAGCTGGGTGAGG - Intronic
1132607987 16:801436-801458 TCAGCCTGCAGAGCTGAGACTGG + Intergenic
1132633424 16:930811-930833 GCAGACTGCTGGGCTGAGAATGG + Intronic
1132717564 16:1299518-1299540 GCAGCCTGCTGTGCGGAGCTGGG - Intergenic
1133266171 16:4585528-4585550 CAAGCCTGCTGGGCTGGGAGGGG + Intronic
1135860914 16:26055181-26055203 GCAGCCTGCTGAGGTCAGAGAGG + Intronic
1137625371 16:49904388-49904410 GCTGTCTGTTGAGCTGGGATGGG - Intergenic
1137719345 16:50618776-50618798 GTGGCTTTCTGAGCTGGGATGGG + Intronic
1138829825 16:60361707-60361729 GCACCCTGCTGAGCTGTGGAAGG - Intergenic
1139282461 16:65782667-65782689 GCAGACTCCTGCTCTGGGATTGG + Intergenic
1139472652 16:67186504-67186526 GCTGCCTGGGGAGCAGGGATAGG + Intronic
1139588398 16:67919071-67919093 GCAGCCATGTGAGCAGGGATAGG + Intronic
1139923175 16:70472182-70472204 GCAGCCTGTTGTGGTGGGCTGGG + Intronic
1141756007 16:85991427-85991449 GGAGGCAGCTGAGCTGGGATTGG + Intergenic
1142344508 16:89545410-89545432 GCAGCCTGGGGAGCAGGGCTGGG + Intronic
1143150687 17:4806508-4806530 AGAGCCTGCTCAGCTGGAATTGG - Intergenic
1143416405 17:6754104-6754126 GTCTCCTGCTGAGATGGGATAGG - Intergenic
1143786288 17:9258229-9258251 GCAGACTCCTGAGCTGAGGTGGG + Intronic
1144542795 17:16160895-16160917 GCAGCCTCCTGAGCCAGAATAGG - Intronic
1144619530 17:16808399-16808421 GGGGCCTGCAGAGCTGGGACTGG - Intergenic
1144783718 17:17820400-17820422 GCTGCCTGGGGAGCTGGTATCGG + Exonic
1144849774 17:18238207-18238229 GCAGCAAGGTGAGCTGGGGTGGG + Exonic
1144893159 17:18507305-18507327 GAGGCCTGCGGAGCTGGGACTGG + Intergenic
1144945214 17:18966252-18966274 TCAGGCTGCTGAGCTGGGGGTGG + Intronic
1145139066 17:20436987-20437009 GAGGCCTGCAGAGCTGGGACTGG - Intergenic
1146341127 17:32020848-32020870 GCGGCCTGCTGTGGTGGGGTGGG - Intronic
1146401772 17:32505213-32505235 GCACCCAGCTCAGCTGGGGTTGG - Intronic
1146791227 17:35751726-35751748 GCAGCCTGATTAGGTGGAATGGG - Intronic
1147165739 17:38592264-38592286 CCAGGCTGCTGGGATGGGATCGG + Intronic
1147563299 17:41521911-41521933 TCAGCCTGGAGACCTGGGATAGG - Exonic
1147626766 17:41905461-41905483 GCAGCCTGCTGGGCTGTCCTGGG + Intronic
1148026983 17:44595275-44595297 GCAGTCTGCTAAGGTGGGGTGGG - Intergenic
1148134380 17:45282893-45282915 GCAGCCTGCACAGCTGCCATTGG - Intronic
1149785134 17:59428262-59428284 ACAGGCAGCTGAGCTGGAATGGG - Intergenic
1149943963 17:60900467-60900489 GTAGCCTGCTTGGCTAGGATAGG - Intronic
1150632418 17:66889347-66889369 GCTGCATGCAGAGCTGGGGTGGG + Intergenic
1150964376 17:69951090-69951112 GAATCCTGCTGAGCTGTGCTGGG - Intergenic
1151880989 17:76894219-76894241 GCAGCCTTCTGGGCTGGGCGGGG + Intronic
1152364704 17:79848927-79848949 GCAGCCTGCCGAGCTGGCGCAGG + Intergenic
1152709758 17:81865498-81865520 GCAGCCTGCTGTGCCCGGAGTGG + Intergenic
1152877589 17:82795908-82795930 CCAGGCTTCTGACCTGGGATTGG + Intronic
1152963502 18:95494-95516 GCAGGCAGCTGGGCTGGGCTGGG + Intergenic
1154021786 18:10669386-10669408 GCAGGCTGCTTGGCTGGGGTGGG + Intronic
1154099840 18:11462435-11462457 GGGGCCTGCTGAGCGGTGATTGG + Intergenic
1155932665 18:31723961-31723983 GCAGCCTGGTGGGGTGGGGTGGG - Intergenic
1158078202 18:53556590-53556612 GCAGACTTTTGAGATGGGATGGG + Intergenic
1158101493 18:53834702-53834724 GAGGCCTCCTGAACTGGGATGGG - Intergenic
1159038086 18:63296708-63296730 TCAGTCTGCTGAGCTGGGCAGGG - Intronic
1159314485 18:66753852-66753874 GGAGCCTGCTAAGCTGGGCCTGG + Intergenic
1159646174 18:70921098-70921120 CCAGCCTGGTGAGGAGGGATGGG - Intergenic
1160597445 18:79986634-79986656 GCATCTTGCTGAGCTGTGCTCGG + Intronic
1161505302 19:4640426-4640448 GCCTCCAGCTGAGCTGGGACTGG - Intronic
1161520056 19:4718818-4718840 GGAGCATGCTCAGCTGGGAAGGG - Intronic
1161906816 19:7163003-7163025 GCAGGCAGCTGTGCTAGGATCGG - Intronic
1162378257 19:10317529-10317551 GCTGCCTTCTGGGCTGGGCTCGG + Exonic
1162501757 19:11058180-11058202 GGAACCTGCTGAGGTGGGGTGGG + Intronic
1162555483 19:11383471-11383493 GCGGCCAGCTGAGCTGGGCGCGG + Intronic
1162576861 19:11504548-11504570 CCAGCCTGCTGTCCTGGGAAAGG + Intronic
1163190325 19:15672739-15672761 GCAGCCAGCTGAGCTGGGCCAGG - Exonic
1163202757 19:15780271-15780293 GGAGCCTCCTGGCCTGGGATGGG - Intergenic
1163677523 19:18662816-18662838 GCAGCCTGGTCAAGTGGGATCGG + Intronic
1164518022 19:28952984-28953006 GCAGACTGCTGAGCTACCATTGG - Intergenic
1165273572 19:34731029-34731051 AGAGCCTGCTGAGCGGGGAGTGG - Intergenic
1165368095 19:35382303-35382325 GAAGGCTGCTGAGATGGGAAAGG + Intergenic
1165396959 19:35569691-35569713 GCTGCCAGCTTAGCTGGGCTGGG - Intergenic
1165542694 19:36505454-36505476 GCAGCCTTCTGAGGTGGCAAGGG + Intergenic
1165899630 19:39163052-39163074 GGAGCCTGCTGTGCCGGGACGGG + Intronic
1167166913 19:47804721-47804743 ACTGCCTGCTGAGCTGTGCTAGG + Intronic
1167174923 19:47859043-47859065 ACTGCCTGCTGAGCTGTGCTAGG - Intergenic
1167773511 19:51538688-51538710 GCAGCCTCCCTGGCTGGGATTGG - Intergenic
1168087704 19:54060529-54060551 GCAGCGAGATTAGCTGGGATTGG + Intronic
1168573804 19:57491619-57491641 CCAGCATCCTGAGCTGGGCTCGG + Intronic
925691530 2:6529038-6529060 GCAGCCTGCGGAGCCGAGAGAGG - Intergenic
925824533 2:7834396-7834418 GCTACCTGCTTAGCTGGAATGGG + Intergenic
926251727 2:11158860-11158882 GCAGCCTGGGGAGGTGGGGTGGG - Intronic
926697165 2:15778879-15778901 GCAGCCTGGGAAGCTGAGATGGG + Intergenic
927855317 2:26524015-26524037 GCTGGCTGCAGAGCTGAGATGGG - Intronic
928123203 2:28598782-28598804 GGAGCCTGCAGAGCAGGGAGTGG + Intronic
928132424 2:28662231-28662253 GCAGAGAGCTGAGCTGGCATTGG - Intergenic
928382756 2:30834285-30834307 GCAGCCTTCTGAGCCAGGGTAGG - Intergenic
929228731 2:39537787-39537809 GCAGCCTCCTGAGCCAGGGTAGG + Intergenic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
930036162 2:47086458-47086480 GCAAGGTGCTGAGCTGGGGTTGG - Intronic
930828776 2:55720501-55720523 GCATCCGGGTGGGCTGGGATGGG - Intergenic
931285290 2:60827121-60827143 GCAGCCTGCTGAGCCAGAGTAGG - Intergenic
932611515 2:73203261-73203283 GCACGCTGCTGAGGTGGGAGAGG + Intronic
934076203 2:88430762-88430784 GCAGCGTGCTGCGGTGGGAAGGG - Intergenic
935345593 2:102104754-102104776 GAAGCCTGCTGAGCTGATGTTGG - Intronic
935801242 2:106698523-106698545 GGAGGCTGCTGAGATGGGAAAGG - Intergenic
936145827 2:109980209-109980231 GCACCCTGTTGAGCTGGGCTGGG + Intergenic
936198862 2:110391269-110391291 GCACCCTGTTGAGCTGGGCTGGG - Intergenic
936863457 2:117050608-117050630 GCAGCCTCCAGAGCTGGAAAAGG - Intergenic
937151483 2:119689380-119689402 GCAGCCAACTCAGCTGGGATGGG + Intergenic
937492296 2:122382702-122382724 CCTCCCTGCTGAGCTGAGATGGG + Intergenic
937854996 2:126665944-126665966 GCAGCCTGCCCTGCTGGGAGGGG + Intronic
938073507 2:128320171-128320193 GCCGCCCGCTCAGCTGGGTTTGG - Intergenic
938116906 2:128608423-128608445 GCCCCCTGCTGGGCTGGGAAAGG - Intergenic
938712344 2:133986187-133986209 GCAGCCAGCAGAGCTAGGAGAGG - Intergenic
939233091 2:139455398-139455420 GCAGCCTGCTCAGCTAGGATTGG - Intergenic
941674364 2:168328238-168328260 GCAATCTGCTGAACTGGAATTGG + Intergenic
941979749 2:171441680-171441702 CCATCTTGCTGAGCTGGGATTGG + Intronic
942617281 2:177806320-177806342 GCAGCCTGGGTAGTTGGGATTGG + Intronic
943371493 2:187022394-187022416 GCAGCTGGCCCAGCTGGGATTGG + Intergenic
945116035 2:206409093-206409115 TGAGGCTGCTGAGCTGGGGTGGG + Intergenic
945971367 2:216234639-216234661 GCAGCCTGCTCAGCCAGGACTGG - Intergenic
946490866 2:220147659-220147681 TCAGCCTGCTGAGAAGGAATCGG - Intergenic
948305252 2:236941797-236941819 GCAGCCTGCAGATCAAGGATCGG + Intergenic
948395314 2:237640912-237640934 TCAGCCTGCTGGGATGGGACAGG + Intronic
948829842 2:240593276-240593298 GGAGCCTGCTGAGGTGGCAAGGG + Intronic
948830373 2:240595662-240595684 GCAAGCTGCAGAGCTGGGACTGG - Intronic
949001811 2:241619108-241619130 GGAGCCTGCAGGGCTGGGAGGGG - Intronic
1169551733 20:6708119-6708141 GCTGTCGGCTGAGCTGGGCTGGG - Intergenic
1169630747 20:7627922-7627944 GGAGCCTCCTGAGCTGAGACTGG - Intergenic
1170219732 20:13929557-13929579 GCAGTGAGCTGAGCTGAGATCGG - Intronic
1170949806 20:20926333-20926355 GCAGCGTGCTCACCTGGGAGGGG - Intergenic
1171957799 20:31473226-31473248 GGAGCCTGTTGAGCTCGGAAGGG + Intronic
1172227930 20:33317552-33317574 GCAGCGTGGCGAGCGGGGATGGG - Intergenic
1173230599 20:41192989-41193011 GCAGCCTGTTCAGCTGGGATTGG - Intronic
1174188211 20:48721942-48721964 GCTGTCTGCTGAGCTGGGGATGG + Intronic
1175731379 20:61356393-61356415 GCTGCTGGCTGAGCTGGGCTGGG - Intronic
1177198579 21:17929546-17929568 GCAGCCTGCTGAGCTGGGATTGG + Intronic
1177297239 21:19191959-19191981 GCAGCCTTCTGAGCCAGGACAGG + Intergenic
1178917817 21:36718774-36718796 GCAGCCTTCTGAGCAGTGGTGGG - Intronic
1179191287 21:39124315-39124337 GAGGCCTGCAGAGCTGGGAGAGG - Intergenic
1179599071 21:42463862-42463884 GCAGCCTTCTGAGCCAGGGTAGG + Intergenic
1180079077 21:45478049-45478071 GGAGTGAGCTGAGCTGGGATCGG + Intronic
1180124455 21:45779406-45779428 GGAGCCTGCCTGGCTGGGATTGG - Intronic
1180125420 21:45786946-45786968 GCAGCCTGCTGGGATGGAAAGGG + Intronic
1180150106 21:45943030-45943052 TGAGCCTGCAGAGCTGGGACAGG - Intergenic
1180207729 21:46272386-46272408 GCAGTCGGCTGAGCTGAGCTGGG - Intronic
1180731625 22:17986562-17986584 TCAGCCTACTTAGATGGGATCGG - Intronic
1181454788 22:23052822-23052844 GCAGCCTCCTGAGCCAGAATAGG + Intergenic
1181629324 22:24142308-24142330 CCTGCCTGCTGAGCTAGGAGAGG - Intronic
1182129310 22:27839301-27839323 GCATCCTGCCGGGCTGGGACAGG - Intergenic
1183100156 22:35578910-35578932 GCAGCCTGCTGCTCTGGTGTGGG - Intergenic
1183609293 22:38887157-38887179 GCAGCAAGCTGAGTTGGCATAGG - Intergenic
1183623091 22:38986183-38986205 GCAGCCTGCAGGGGTGGGACTGG + Intronic
1183758219 22:39790621-39790643 GAAGCCTGGTGAGTTGGGACTGG - Intronic
1183775204 22:39959615-39959637 GCAGCCGGCTGAGCAGGGCCTGG - Intronic
1184222462 22:43109938-43109960 GCAGCCTGCTACGCGGGGATGGG - Intergenic
1184405895 22:44300624-44300646 GCAGCCAGCTGAGCTCCCATGGG + Intronic
1184449509 22:44574680-44574702 GCAGGCTGCTGAGCCGGAAGGGG + Intergenic
1185331965 22:50255972-50255994 GGAGGCTGTTGAGCTGGGGTGGG - Intronic
949124678 3:432984-433006 GCAGTCTACTGACTTGGGATTGG - Intergenic
949418960 3:3844992-3845014 GCAGCGTTGTGAGCTGGGTTAGG - Exonic
950186547 3:10949031-10949053 TCACTCAGCTGAGCTGGGATGGG - Intergenic
950401873 3:12775290-12775312 GCATCCTGCTGAGGTGGGCTGGG + Intergenic
950531941 3:13557245-13557267 GCAGCCTGCTGCCCTAGGAGGGG + Intronic
950654179 3:14426417-14426439 GCAGCCCAGGGAGCTGGGATTGG + Intronic
950895030 3:16440824-16440846 GCAGCCTGCAGAGTATGGATGGG + Intronic
951340406 3:21479612-21479634 GCAGCCTGCTGAACACTGATAGG - Intronic
952968674 3:38637091-38637113 CCAGCCTGATGAGCTGCGGTAGG - Intronic
953061996 3:39435023-39435045 GCAGCCTCCTTGGATGGGATGGG - Intergenic
953907537 3:46875845-46875867 GGAGCCTGTTGAGCTCGGAGGGG + Intronic
954376127 3:50195074-50195096 GGAGCCTGAGGAGCTGGGGTGGG - Intronic
954699908 3:52445721-52445743 CAAGCCTGGTGAGCTGAGATGGG - Intergenic
954748350 3:52799682-52799704 ACCGCCTGCTGAGCTGAGAAGGG + Intronic
955846666 3:63170634-63170656 GCAGCCTGTAGAACTGGGAAGGG - Intergenic
960014619 3:112872208-112872230 GCAGCCAGCCTGGCTGGGATAGG - Intergenic
960753673 3:120983753-120983775 GCAGCCTACTGGGCTGGGATAGG - Intronic
962217282 3:133533481-133533503 GCAGACTGCTGTGGTGGGCTAGG + Intergenic
962254992 3:133864506-133864528 GAAACTTGCTGAGCTGGGGTGGG - Intronic
963314501 3:143744528-143744550 GCAGGCTGCTGAGTAGCGATGGG - Intronic
964518788 3:157542006-157542028 GCAGCATGCTGAGCTGTGGGTGG + Intergenic
965095971 3:164226350-164226372 GCAGCCTCCTGAGCCAGAATAGG + Intergenic
965839537 3:172887586-172887608 TCAGCCTGCTCAGCTGGGATTGG - Intergenic
966434869 3:179871804-179871826 GCAGCCTGCTGAGCCAGAGTAGG - Intronic
966642664 3:182208213-182208235 GCAGCCTGCAGAACTGGGTGTGG - Intergenic
966852128 3:184170781-184170803 GCAGCCGGCTGGGGTGGGAGCGG - Exonic
966928901 3:184663108-184663130 ATGGACTGCTGAGCTGGGATGGG - Intronic
967905749 3:194498334-194498356 TCAGCCTGAGTAGCTGGGATGGG - Exonic
968142430 3:196269586-196269608 GTAGCAAGCTGAGATGGGATAGG + Intronic
968517911 4:1022606-1022628 GCAGCCAGCTGAGGTGGGGCAGG - Intronic
968782549 4:2594035-2594057 GATGGCTGCTGAGCTGGGTTTGG + Intronic
968810900 4:2799293-2799315 GCTGCCTAATGAGGTGGGATGGG + Intronic
969479702 4:7441401-7441423 ACAGCCTGATGAGCTGGGTGAGG + Intronic
970695060 4:18667490-18667512 GCAGCCTCCTGAGCCAGAATAGG + Intergenic
970757323 4:19442709-19442731 GCAGCCTGCTCGGCCAGGATTGG + Intergenic
971166834 4:24192197-24192219 GAGGACTGCAGAGCTGGGATGGG - Intergenic
971703859 4:30013914-30013936 GCACCCTGCAAGGCTGGGATTGG - Intergenic
971881119 4:32374256-32374278 CAAGATTGCTGAGCTGGGATAGG + Intergenic
972121755 4:35712435-35712457 GCAGCCTGCTATTCTGGGATTGG + Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
978111110 4:104964598-104964620 GCAGCCTGCCTGGCTGGCATTGG - Intergenic
979475084 4:121147057-121147079 TCAGCCTGTTCAACTGGGATTGG + Exonic
979764600 4:124448480-124448502 GCAGCCTGCTTACCCAGGATTGG - Intergenic
980252158 4:130331433-130331455 GCAGCCTCCTGAGCCAGAATGGG + Intergenic
980602695 4:135045595-135045617 GGAGGCTGCTGAGATGGGAAAGG + Intergenic
982070423 4:151689405-151689427 CCAGCCTTCTGAGCTGGGCCAGG + Intronic
982563289 4:156957680-156957702 GCTGCCTGCATAGCTGGGATGGG + Intronic
982668272 4:158291973-158291995 CCAGGCTGCTGAGCGGGGGTGGG + Intergenic
983169599 4:164520912-164520934 CCAGACTGCTGTGCTGGCATTGG + Intergenic
983886095 4:172982239-172982261 GAAGCCTGCTGAGCTGCATTTGG - Intronic
984383087 4:179019530-179019552 GCAGCCTCCTGAGCCATGATAGG - Intergenic
984831877 4:183983540-183983562 GCAGACTTCTGAGTTGTGATAGG + Intronic
985620362 5:951913-951935 GGGGCCAGCTGAGCTGGGAGGGG - Intergenic
986338038 5:6769392-6769414 GCAGCCCACTGTGCAGGGATGGG + Intergenic
987107360 5:14653173-14653195 GGAGACTGCTGAGATGGGAAAGG - Intergenic
988045039 5:25939764-25939786 GCAGCCTGGTGAGCCTGGAAAGG - Intergenic
988680431 5:33479847-33479869 GCAGCCTCCTGAGCCAGAATAGG + Intergenic
989632141 5:43496301-43496323 GGAGGCTGCTGAGATGGGAAAGG - Intronic
992785731 5:80168865-80168887 GCTGCTGGCTGAGCTGGGATGGG + Intronic
993135513 5:83956522-83956544 TCTGCCTGCTGAGTTGGGAAAGG - Intronic
994467558 5:100157716-100157738 GCAGCCTCTTGAGCTGGAGTAGG + Intergenic
997440596 5:133906222-133906244 GCAGCCAGCTGAGCTGGGAAAGG - Intergenic
997470741 5:134115484-134115506 GCCGCCTCCTGAGCTGCGGTGGG - Intronic
997671735 5:135680054-135680076 GCAGCCTGCTTGGCTGGGATTGG - Intergenic
997690790 5:135826180-135826202 GCAGCCTGGTGGGCTGAGAGGGG - Intergenic
997795960 5:136811247-136811269 GGAAGCTTCTGAGCTGGGATGGG + Intergenic
998157855 5:139796368-139796390 GCAGCCTGGTGGTCGGGGATCGG + Intronic
998752539 5:145339301-145339323 GCAGCTTGCTCAGCCAGGATTGG + Intergenic
998967093 5:147552659-147552681 ATAGCATGCTGAGGTGGGATGGG + Intergenic
999076477 5:148800639-148800661 CCACTCTGCTGTGCTGGGATTGG + Intergenic
999379392 5:151109713-151109735 TCTTCCTGCTGAGCTGGGAAGGG + Intronic
1001312696 5:170622816-170622838 CCAGCCTCCAGAGCTGGGAAGGG + Intronic
1001936985 5:175712343-175712365 CCACCCAGCTCAGCTGGGATGGG - Intergenic
1002527808 5:179824553-179824575 GCAGCCTCCTGAGGTAGGAAGGG - Intronic
1002643502 5:180641554-180641576 GCTGCTGGCTGAGCTGGGGTTGG + Intronic
1002912875 6:1504586-1504608 GCAGCCTGCTGGTTTGGGACTGG + Intergenic
1002928272 6:1617570-1617592 GCAGGCCCCTGAGCTGGGCTCGG - Intergenic
1003129297 6:3381593-3381615 GAAGGCTGTAGAGCTGGGATTGG - Intronic
1004196832 6:13512790-13512812 GAAGCCAGCTGGGTTGGGATGGG + Intergenic
1004622941 6:17347164-17347186 GCAGGCTCCTCAGCTGTGATTGG + Intergenic
1004685071 6:17935351-17935373 GCTGCCTGCTGAGCTGAGCCAGG - Intronic
1006105416 6:31713573-31713595 CCAGCCTGATGAGGTGGGAAAGG - Intronic
1006113596 6:31763405-31763427 GCATCCTGCGTAGCTGGGAAAGG - Exonic
1007349190 6:41256197-41256219 GAAGCCAGCTGAGGTGGGAGTGG - Intergenic
1007518024 6:42428979-42429001 GCAGCAGGCTGAGCTGTGGTTGG + Intronic
1009354730 6:62728130-62728152 GCAGCCTGCTTAGCTGGGATAGG - Intergenic
1009637268 6:66281728-66281750 GTAGCCTGGTGATCTGGGGTAGG - Intergenic
1010203014 6:73299431-73299453 GCTGACTGCGGAGCTGGGAGGGG + Intronic
1013895969 6:115088581-115088603 GGAGCCTGGTGAGATGTGATTGG - Intergenic
1014505242 6:122247385-122247407 GCAGCATGGTGAGCTGGGGCAGG + Intergenic
1015293789 6:131567483-131567505 GCAGCCTTCTGAGCCAGGGTAGG - Intergenic
1015355409 6:132272105-132272127 GAAGTCTGCTGAGATGGGAAAGG + Intergenic
1015579499 6:134708058-134708080 GCAGCCTTCTTAGCATGGATTGG - Intergenic
1015696439 6:135985331-135985353 GCAGCTTTCTGAGGTTGGATAGG + Intronic
1015858021 6:137646208-137646230 GTAGCCTACTTGGCTGGGATTGG - Intergenic
1016132359 6:140491181-140491203 GCAGCCTTCTGAGCCAGGGTAGG + Intergenic
1016948104 6:149552496-149552518 GCAGCTTGCTCAGCCAGGATTGG - Intergenic
1017029901 6:150211799-150211821 GACGCATGCTGAGCTGGGAGCGG + Intronic
1017336615 6:153268676-153268698 GCAGCCTGTTGGGCTGGGATTGG + Intergenic
1017358339 6:153536487-153536509 GAAGGCTGCTGAGCTGGCAGTGG - Intergenic
1017980694 6:159398863-159398885 GCAGCCTCCTGAGCTAGAGTAGG - Intergenic
1018349564 6:162942964-162942986 GCAGCCAGCTCAGCTGGGATTGG + Intronic
1019039783 6:169094318-169094340 ACAGCCTGCTGACCGGGGAGAGG - Intergenic
1019611193 7:1937489-1937511 CCAGCCTGCTGACCTGTGGTGGG + Intronic
1019653363 7:2172771-2172793 GCAGCCAGCAGGGCTGGGATGGG - Intronic
1020109890 7:5442057-5442079 GCTGGGGGCTGAGCTGGGATGGG - Intronic
1020838163 7:13181110-13181132 GCACACTGGTGACCTGGGATAGG - Intergenic
1021420494 7:20440855-20440877 GCAGAGTGCTGAGGTGGGAAGGG - Intergenic
1021616990 7:22511846-22511868 GGAGGCTGCTGAGATGGGAAAGG - Intronic
1023232884 7:38052230-38052252 GCAGCCTGCTTGCCGGGGATGGG - Intergenic
1023541986 7:41275444-41275466 GCAGCCTGTTGGGCTGGGCATGG - Intergenic
1023796816 7:43800292-43800314 GCAGCCTCTTCAGCTGGGGTGGG + Intronic
1023889596 7:44382738-44382760 GCAGCCAGCTCAGCTGGGGAAGG - Exonic
1024997910 7:55288358-55288380 GCAGCCTCCTGAGCCAGAATAGG - Intergenic
1025832200 7:65062168-65062190 TCAGGCTGCAGAGCAGGGATGGG + Intergenic
1025919878 7:65901597-65901619 TCAGGCTGCAGAGCAGGGATGGG + Intronic
1026951734 7:74352000-74352022 GCAGCCAGCCCAGCTGGGAGTGG + Intronic
1028259077 7:88639144-88639166 GGAGGCTGCTGAGATGGGAACGG + Intergenic
1029157917 7:98530411-98530433 GGGGCCTGCTGAGATGTGATTGG + Intergenic
1030541344 7:110834273-110834295 ACAGGCTGCTGTGCTGGTATGGG - Intronic
1031684029 7:124709852-124709874 GCAGCCAGCTTGGCTGAGATTGG - Intergenic
1032094978 7:128933471-128933493 TCAGGATGCTGAGCTGGGAGAGG + Intergenic
1033779104 7:144648422-144648444 GGAGGCTGCTGAGATGGGAAAGG - Intronic
1034260354 7:149751514-149751536 CCAGCCCGCTGAGCAGGGAGGGG + Intergenic
1036207367 8:6815137-6815159 GAAGCCTGCTGTGCTGGGAGAGG + Intronic
1036691655 8:10948392-10948414 GCAGCCTTCTCAGCTGGCAGAGG - Intronic
1036733384 8:11285083-11285105 GCTCCCTGCGGAGCTGGGGTGGG - Intronic
1037828167 8:22172265-22172287 GCTGCATGCTGAGCTGGGCTGGG - Intronic
1038175416 8:25177828-25177850 GCAGCCTCCTGAGCCGGGGTAGG + Intergenic
1038336962 8:26653228-26653250 GCAGCTGGCTGAGCTGAGAGGGG + Exonic
1039661910 8:39477258-39477280 GCAGCATCCTGAGGTGGAATTGG - Intergenic
1040037729 8:42886774-42886796 GCAACCTGGGAAGCTGGGATGGG + Intronic
1040302356 8:46194674-46194696 GGGGCCTTCTGAGATGGGATAGG - Intergenic
1040315440 8:46258469-46258491 GCAGGCTGCTGCGATGGGAGAGG - Intergenic
1041006927 8:53504325-53504347 GCGGCCTGCTGAGTTGGGAATGG + Intergenic
1041830409 8:62147247-62147269 GCAGCCTGCTTGGCTGGGATTGG + Intergenic
1043198489 8:77330906-77330928 GCAGTCTGTTTGGCTGGGATTGG - Intergenic
1044040114 8:87356925-87356947 GCAGCGTCCTGAGGTGGCATAGG - Intronic
1044466224 8:92509637-92509659 ATAGCTTGCTGAGGTGGGATTGG - Intergenic
1046720234 8:117610944-117610966 GCAGCCTTCTGAGCCAGAATAGG + Intergenic
1046867501 8:119167160-119167182 GAAGCCTTCTGAGCTGGAGTAGG + Intronic
1047918565 8:129608778-129608800 ACATCTTGCTGAGCTGGAATGGG + Intergenic
1048028205 8:130606127-130606149 GCAGCTTTCTCAGCTTGGATTGG + Intergenic
1048580483 8:135726174-135726196 GCAGCCTGGCTGGCTGGGATTGG - Intergenic
1048759106 8:137771596-137771618 GCTGCCTGCTCACCTGCGATTGG - Intergenic
1049099552 8:140569108-140569130 GTTGCCTGCTGACCTGGGATGGG - Intronic
1049210352 8:141383685-141383707 CCAGCCTGCTGTCCTGGGCTCGG - Intergenic
1049348086 8:142149383-142149405 GGAGCTGGCTGAGGTGGGATGGG + Intergenic
1049655642 8:143795736-143795758 GCAGCCCTGTGAGCTGTGATGGG - Intronic
1050380546 9:5023645-5023667 ACAGCCTGCCCAGCCGGGATTGG - Intronic
1051108171 9:13604129-13604151 ACAGCCTGCTCAGCTGTGATTGG - Intergenic
1051664057 9:19451617-19451639 TGAGGCTGCTGAGCTGGGGTGGG - Exonic
1052459301 9:28741915-28741937 TCAGCCTGGTTAGCTAGGATTGG + Intergenic
1053181241 9:35972222-35972244 GCTGCCTGCAGTGCTGGGGTGGG + Intergenic
1053413335 9:37929647-37929669 GCAGCCTGCCTGGCTGGGGTGGG + Intronic
1055130464 9:72768716-72768738 GCAGCCAGCTCATCTGGCATAGG - Intronic
1055309496 9:74964258-74964280 GCAGCCTGCTCAGCTGGGATTGG + Intergenic
1055439621 9:76325166-76325188 GCAGGCTGTGGAGCTGGGAATGG + Intronic
1057055756 9:91959474-91959496 TCATCCTGCTGAACTGTGATGGG - Intergenic
1057558484 9:96108373-96108395 CCACCGTGCTGAGCTGGGAGTGG + Exonic
1057585090 9:96321779-96321801 GCAGTTTGCGGGGCTGGGATCGG - Intronic
1057781366 9:98053432-98053454 CCAGCCTGCTGAACTGGCTTTGG + Intergenic
1058218194 9:102261109-102261131 GCAGCCTCCTGAGCCAGAATAGG - Intergenic
1058291919 9:103253105-103253127 GCATTATGCTCAGCTGGGATTGG - Intergenic
1058651053 9:107176129-107176151 GCAGGTAGCTGAGCTGGGCTTGG - Intergenic
1059053238 9:110952174-110952196 GCAGCCTGCTGTTCTGGGACTGG + Intronic
1059409502 9:114123303-114123325 GGAGCTGGCTAAGCTGGGATGGG + Intergenic
1059476224 9:114550090-114550112 GCAGGCAGCCGAGATGGGATTGG - Intergenic
1060307687 9:122430956-122430978 GCAGCCACCAGAGCTGGGAAAGG - Intergenic
1060938379 9:127528907-127528929 GCCTCCTGCTGGGCTGGGACTGG - Intronic
1061375755 9:130223291-130223313 GCTAGCTGCTGAGCAGGGATAGG - Intronic
1061527160 9:131175555-131175577 GCTGCCTGCGGGGCTGAGATGGG - Exonic
1061784650 9:133019617-133019639 GGAGGCTGCTGAGATGGGAAAGG + Intergenic
1062121464 9:134836168-134836190 ACAGCCTGCAGAGCTGGGAGCGG - Intronic
1062546566 9:137066247-137066269 GCGGCCTGGTGAGCAGGGACTGG - Exonic
1062618005 9:137406861-137406883 CCAGCCTGCTGAGGGGGGACGGG - Intronic
1062734591 9:138128234-138128256 GCAGGCAGCTGGGCTGGGCTGGG - Intergenic
1186914683 X:14206840-14206862 GCAGCCCGCAGAGCAGGGAGAGG - Intergenic
1187410987 X:19050344-19050366 GCAGCCTGCTCAGCTGTCACAGG - Intronic
1188060171 X:25591058-25591080 GCAGTCTGTTTGGCTGGGATTGG - Intergenic
1188872002 X:35383434-35383456 ACAGCCAGCTGAGCTGGGACTGG - Intergenic
1189660013 X:43286524-43286546 GCAGCCTGCTGAGCTGGGACTGG - Intergenic
1189859030 X:45253033-45253055 GCAGCCTGCTCAGCCAGGATTGG - Intergenic
1191768831 X:64733050-64733072 CCTGCCTGCTGAGGAGGGATGGG + Intergenic
1192659599 X:73028910-73028932 GCAGCCTGCTTCTCTGGGATGGG + Intergenic
1193313500 X:80037187-80037209 GCAGCCTCCTGAGCCAGGGTAGG + Intergenic
1193549641 X:82875340-82875362 GCAGCTTGCTGAGTTAGAATTGG + Intergenic
1193943568 X:87706154-87706176 GCAGCCCGCTAGGCAGGGATTGG + Intergenic
1194401147 X:93439338-93439360 GCAGCCTGCTGGGCCAGGATAGG + Intergenic
1194872192 X:99146380-99146402 GCAGCCTGCTTGGCTGGAATTGG + Intergenic
1195330675 X:103796702-103796724 CCAGTCAGCTGAGCTAGGATAGG - Intergenic
1196455754 X:115890476-115890498 TCAGACTGCTGAACTGGGCTTGG + Intergenic
1196574708 X:117304650-117304672 GCAACCTGCTCAGCTGAGATTGG + Intergenic
1196825293 X:119735745-119735767 GCAGACTGCTCATCTGGGAGAGG + Intergenic
1196998992 X:121416866-121416888 GCAGCCTACTCAACTGGGATTGG - Intergenic
1197309377 X:124884585-124884607 GCAGCCTGCTCAGCTGGAATGGG - Intronic
1197525350 X:127555449-127555471 GTATCCTGCTGTGCTGAGATTGG + Intergenic
1197643612 X:128993436-128993458 GTAACCTGCTTGGCTGGGATGGG - Intergenic
1197904491 X:131410528-131410550 GCAGCCTGCTCAGTTGAGATTGG + Intergenic
1198259486 X:134952982-134953004 GCAGCCTACAGAACTGTGATGGG - Intergenic
1198583613 X:138095701-138095723 GCAGCCTGCTTGGTTAGGATTGG + Intergenic
1198725140 X:139668572-139668594 GCAGCCTGCTTGGCCGGGATTGG - Intronic
1199858066 X:151776647-151776669 CCTGCCTGCTGAGCTTGGCTTGG + Intergenic
1200206659 X:154321290-154321312 ACAGCCTGCTCAGGTGGGAGGGG + Intronic
1200254576 X:154573261-154573283 GCAATCTGCAGAGCTGGGGTGGG - Intergenic
1200263193 X:154631147-154631169 GCAATCTGCAGAGCTGGGGTGGG + Intergenic
1200345061 X:155439759-155439781 GCAGCCTGCTTGGCCAGGATTGG + Intergenic
1201368720 Y:13237427-13237449 GCAGCCTGCTTGGCCAGGATGGG + Intergenic
1201390355 Y:13490570-13490592 GCAGCCTGCTTGGCTGGGATTGG - Intergenic
1202042396 Y:20698718-20698740 GCAGCTTGCTGGGCTAGGATTGG - Intergenic