ID: 1177198739

View in Genome Browser
Species Human (GRCh38)
Location 21:17930326-17930348
Sequence GCTGCTAATAAGATGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177198739_1177198743 -9 Left 1177198739 21:17930326-17930348 CCTGCTTTCATCTTATTAGCAGC 0: 1
1: 0
2: 2
3: 8
4: 151
Right 1177198743 21:17930340-17930362 ATTAGCAGCAGTTGTAGGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 204
1177198739_1177198742 -10 Left 1177198739 21:17930326-17930348 CCTGCTTTCATCTTATTAGCAGC 0: 1
1: 0
2: 2
3: 8
4: 151
Right 1177198742 21:17930339-17930361 TATTAGCAGCAGTTGTAGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 112
1177198739_1177198745 -2 Left 1177198739 21:17930326-17930348 CCTGCTTTCATCTTATTAGCAGC 0: 1
1: 0
2: 2
3: 8
4: 151
Right 1177198745 21:17930347-17930369 GCAGTTGTAGGGAGGGAACAGGG 0: 1
1: 0
2: 1
3: 24
4: 265
1177198739_1177198744 -3 Left 1177198739 21:17930326-17930348 CCTGCTTTCATCTTATTAGCAGC 0: 1
1: 0
2: 2
3: 8
4: 151
Right 1177198744 21:17930346-17930368 AGCAGTTGTAGGGAGGGAACAGG 0: 1
1: 0
2: 3
3: 20
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177198739 Original CRISPR GCTGCTAATAAGATGAAAGC AGG (reversed) Intronic
904418983 1:30379408-30379430 GCTGCTTCAAAGATGAAGGCGGG - Intergenic
907533071 1:55121503-55121525 GATGCTAATAAGAAGAAATGGGG + Exonic
907586699 1:55624463-55624485 TCTGGTAATAAGATCATAGCTGG + Intergenic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
909784613 1:79595286-79595308 TCTGCTTATAAAATGAAACCTGG - Intergenic
915787852 1:158635578-158635600 GCTGATTATAATATGAAAACTGG + Intronic
920667265 1:207972143-207972165 TCTGGAAAGAAGATGAAAGCTGG - Intergenic
1064041271 10:11966964-11966986 AATACTAATAAAATGAAAGCTGG - Intronic
1064057926 10:12113496-12113518 GCTGTTTAAAAAATGAAAGCAGG - Intronic
1064465699 10:15578459-15578481 GCTGCTATTAAGATTAATGTAGG + Intronic
1064620227 10:17207952-17207974 TCTGCTAAAAATATAAAAGCTGG - Intergenic
1066459413 10:35600128-35600150 GCTGCCTATTAGATGCAAGCAGG - Intergenic
1068754455 10:60635350-60635372 GCTTCTAATAAGATTCATGCCGG - Intronic
1069353151 10:67553548-67553570 GCTGCTAATAAGTAAAATGCAGG - Intronic
1070581263 10:77721653-77721675 GCTGTTAAAAAGATAAAATCAGG - Intergenic
1071809794 10:89166987-89167009 GCACCTAAGAAGCTGAAAGCTGG - Intergenic
1072081405 10:92036018-92036040 ACTGCTAACAAAAAGAAAGCTGG + Intergenic
1073241071 10:102058596-102058618 GCTGTTAAAAAAATTAAAGCGGG + Intergenic
1073704513 10:105968064-105968086 GCTGAGTATAAGGTGAAAGCAGG + Intergenic
1075570361 10:123537352-123537374 TCTGCTAATAAGACTAAAGAGGG + Intergenic
1076680326 10:132168389-132168411 CCTGATGACAAGATGAAAGCTGG + Exonic
1078025487 11:7691315-7691337 GCTTCCAATCAGATGAAAACGGG - Exonic
1080406692 11:31986436-31986458 ACCGTTAATAAGATGAAACCAGG - Intronic
1080599105 11:33805036-33805058 GCTCCTCATATGATGACAGCTGG - Intergenic
1080647903 11:34200103-34200125 GCTGCTAATAAGTTGAAACCTGG + Intronic
1080782227 11:35440271-35440293 GTTGCTAATTAGATGAATGTTGG - Intronic
1083348539 11:62011221-62011243 TTTGCTGATAAGATCAAAGCTGG + Intergenic
1085022352 11:73217754-73217776 GCTGCTGATAAGATTAAGGCAGG + Intergenic
1087162000 11:94958256-94958278 GCTGCTAACGAGAAGAAAACTGG - Intergenic
1088174001 11:107030373-107030395 GCTTCTTATAAGAGGAATGCGGG + Intergenic
1089941859 11:122427028-122427050 GCTGCTATCAAGATGATGGCTGG - Intergenic
1090195271 11:124810456-124810478 TCTACTAATAAGATGTAAACTGG + Intergenic
1093029836 12:14278096-14278118 GCTGGTAAAAAGAAGAAAGTCGG + Intergenic
1097249361 12:57624126-57624148 GATGCTAACAAGATGAGAGGGGG - Intronic
1097483781 12:60167234-60167256 AATTCTTATAAGATGAAAGCAGG + Intergenic
1100492051 12:95090141-95090163 GAAGATAATAAGATAAAAGCTGG + Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102659965 12:114517746-114517768 GATGCTAAAAAGATGAAACAGGG - Intergenic
1102970526 12:117162491-117162513 GCTGCTAAGAAGATGGAAGGAGG + Intronic
1103372707 12:120431598-120431620 GCTGTTAAAAACAAGAAAGCAGG - Intergenic
1104364788 12:128167096-128167118 GCTTCTTATAAGAGGGAAGCAGG - Intergenic
1106218427 13:27723601-27723623 GCTGCTATTAAGAAGAATGAAGG - Intergenic
1108084269 13:46768634-46768656 ACTGCTAATAAGGTGCAATCTGG - Intergenic
1108869719 13:54968704-54968726 GGTGCTAAGAAGAAGAAAGAGGG - Intergenic
1113102781 13:106738167-106738189 GCTGCTAATAGGAATAAAGTTGG - Intergenic
1115121179 14:29940254-29940276 GCTGCTCATAACATGACAGAGGG + Intronic
1116001892 14:39252297-39252319 GCTACTTATAAGAGGAAGGCAGG + Intronic
1118504905 14:66400518-66400540 GCTGCTATTATTATGAAAACTGG - Intergenic
1121902225 14:97704084-97704106 GGTCCTTATAAGAGGAAAGCAGG - Intergenic
1123154987 14:106216136-106216158 GCCTCTAATAACATTAAAGCAGG + Intergenic
1123787609 15:23688412-23688434 GCTGCTGATGAGAAGAAACCCGG - Intergenic
1125024735 15:35019136-35019158 GCTGCTTATAAGATGAAAAAAGG + Intergenic
1127414579 15:58745495-58745517 GCTGCTACTATTATGAAAACGGG + Intronic
1127639787 15:60905546-60905568 GTTGCTAAACAGATGAAAGTAGG + Intronic
1129669396 15:77598727-77598749 GCTGCTGGTAAGAGGGAAGCCGG + Intergenic
1130573895 15:85073582-85073604 TCTTCTAAAAAGCTGAAAGCTGG + Intronic
1133831332 16:9326182-9326204 GCTGCTATGAAGATTAAAGAAGG - Intergenic
1134766784 16:16766096-16766118 GCTCCTTATAACATGTAAGCAGG + Intergenic
1138481152 16:57304161-57304183 GCTGCTGATAAGGTGGAAACAGG - Intergenic
1140403962 16:74695289-74695311 GATGCTAAGAAGAGGCAAGCTGG - Exonic
1151246031 17:72795377-72795399 GCTGCTGATAACATGGCAGCTGG + Intronic
1152060036 17:78065672-78065694 TCTGTTGACAAGATGAAAGCAGG - Intronic
1152279407 17:79376449-79376471 GCTGCCAACATGAAGAAAGCTGG + Intronic
1154200631 18:12297590-12297612 GCTGCTCAGAAGATGATAGGAGG + Intergenic
1155140797 18:23042752-23042774 GCTGATAATAAAATGAAACATGG - Intergenic
1155229386 18:23757899-23757921 GCTGCTAATAAGATCCCAGAGGG - Intronic
1155945194 18:31840811-31840833 GCTGGAAATAAAATAAAAGCTGG + Intronic
1157245097 18:46046636-46046658 GCTTATAAGAAGAAGAAAGCAGG + Intronic
1157607144 18:48933061-48933083 GCTGATTGTAAGATGACAGCAGG - Intronic
1157711541 18:49853151-49853173 GCTTCCAAGAGGATGAAAGCAGG - Intronic
1159981240 18:74783138-74783160 ACTGCTAATAAGGTCAAAGAAGG - Intronic
1160030375 18:75252209-75252231 GCTGTTTATAATATGAAAGTGGG - Intronic
1161914100 19:7216020-7216042 GTGGCTAAGAAGATGGAAGCAGG + Intronic
1161950437 19:7464771-7464793 GATGCTAATAAGACTAAAACTGG - Intronic
1164890729 19:31821095-31821117 CCTTCTAAGAAGAGGAAAGCTGG - Intergenic
1166459007 19:42969531-42969553 GCTGTGATTAAGATGAGAGCAGG + Intronic
925386458 2:3465291-3465313 GCTGTTTAGAAGATGGAAGCAGG + Intronic
926570282 2:14522111-14522133 GCTACAATTAAGATGAAATCTGG - Intergenic
931763339 2:65434982-65435004 GCTGCTATTAAGCAGAGAGCTGG - Intergenic
932535554 2:72590146-72590168 GTTGCTAATGAGATGAAGGATGG + Intronic
937179457 2:119977608-119977630 GCTGCTCAGAAGAAGAAAGATGG + Exonic
938798361 2:134737667-134737689 GATCCTTATAAGAAGAAAGCAGG - Intergenic
938860333 2:135361591-135361613 GCTGCTTATAACATTAAAACCGG - Intronic
940001746 2:148973541-148973563 TCTGCTACAAAGATGAAAGATGG + Intronic
941107974 2:161382223-161382245 GCTACTAACAAGAAGACAGCAGG + Intronic
946375576 2:219307199-219307221 GGTCCTAAGAAGATGGAAGCTGG + Intronic
947207948 2:227679665-227679687 GCTGTTAATAAATTGAAAACAGG + Intergenic
1171135301 20:22689928-22689950 GCTGCTCTTAAGATTAAATCTGG + Intergenic
1173869715 20:46333584-46333606 GCTGCTAATGAAATGAAATGAGG + Intergenic
1174635631 20:51997246-51997268 GCTGCTAATAAAATCATACCTGG + Intergenic
1175676894 20:60953899-60953921 TCTGCAAAGAACATGAAAGCAGG - Intergenic
1177198418 21:17927593-17927615 GCTGCTATTAAAATGAAAGCAGG - Intronic
1177198739 21:17930326-17930348 GCTGCTAATAAGATGAAAGCAGG - Intronic
1177297495 21:19195779-19195801 GACGCCAACAAGATGAAAGCAGG + Intergenic
1177638932 21:23821298-23821320 GCTGAAACTAGGATGAAAGCAGG + Intergenic
1178013053 21:28308672-28308694 GATGCCAATATGATGAAAGGTGG + Intergenic
1182027551 22:27132363-27132385 GCTGCTCAGCAGATGGAAGCAGG + Intergenic
1182489419 22:30661003-30661025 TCTGCTAAAAATACGAAAGCAGG - Intronic
1182693247 22:32178028-32178050 TCTGGGAATAAGTTGAAAGCTGG + Intergenic
1184453975 22:44598853-44598875 GCTGCTAAGAAGAGGAAGGAGGG + Intergenic
949724153 3:7024168-7024190 GTTGTAAATAAGATGAAAGGAGG - Intronic
950435812 3:12979272-12979294 GCTGATAACAGGATCAAAGCAGG - Intronic
951171628 3:19548858-19548880 GCTGCCATTAAGATATAAGCAGG - Intergenic
953072664 3:39537544-39537566 GCTTTTAATAAAATGAAAGGAGG - Intergenic
954439279 3:50512722-50512744 CCTGGGAATAAGATGAACGCTGG + Intergenic
955137745 3:56236667-56236689 GATGGTAATAATATGAAAGCAGG + Intronic
956635258 3:71357619-71357641 GTGGCTAATAGGATGTAAGCAGG + Intronic
960908691 3:122626765-122626787 GTTGCTAATATGATGAAATATGG - Intronic
961571469 3:127802288-127802310 GCTGCTCATAAAATGCAAACAGG + Intronic
962303416 3:134264149-134264171 AATGCTAACAAGAAGAAAGCTGG - Intergenic
963454722 3:145530130-145530152 GCACCTAATAAGATGGAAGCAGG + Intergenic
964932194 3:162040210-162040232 GTTTCTATTAAAATGAAAGCTGG - Intergenic
965467443 3:169048026-169048048 GCTGTTACAGAGATGAAAGCTGG + Intergenic
965602154 3:170466252-170466274 CCTGGTGATATGATGAAAGCGGG - Exonic
965644188 3:170862703-170862725 ACTGCTGATAACATGACAGCTGG - Intergenic
966173609 3:177111598-177111620 GATGCTTATAAGATGATAGTGGG - Intronic
966399753 3:179536020-179536042 GCTGTGAATATGATGAAAGCAGG + Intergenic
968713654 4:2138709-2138731 CTGGCCAATAAGATGAAAGCTGG + Intronic
968793660 4:2687602-2687624 GGAGCTATCAAGATGAAAGCTGG - Intronic
977114456 4:93005455-93005477 GCTGCTGAAAGAATGAAAGCTGG - Intronic
977153161 4:93539681-93539703 ACTGCAAATAAAATGCAAGCAGG - Intronic
977227122 4:94405882-94405904 GCTTGTAAGAAGATGAAAGGTGG - Intergenic
979461410 4:120988723-120988745 CCTGTTAATATGATGATAGCTGG + Intergenic
980461760 4:133124607-133124629 GATGCTACTAATATGAAAGTAGG + Intergenic
981692493 4:147524989-147525011 TCAGCTCATAAAATGAAAGCAGG - Intronic
981707218 4:147673019-147673041 GCAGCAAACAAGATGGAAGCAGG - Exonic
984391279 4:179137234-179137256 GCTGCTACAAAAATGAGAGCAGG - Intergenic
988081877 5:26425677-26425699 GGTACTAATAAGAAGAAAGCTGG - Intergenic
990092264 5:52066736-52066758 ATTGCTAACAAGATGAAAACAGG + Intronic
990325850 5:54674576-54674598 GCTGTTGATAGGATGATAGCTGG - Intergenic
991450166 5:66743173-66743195 GCTGTGAAGAAGAAGAAAGCAGG - Intronic
993133019 5:83923157-83923179 GCTGATGATATGATTAAAGCAGG - Intergenic
996539676 5:124616570-124616592 GCTGCAAATAACATGACAGAGGG + Intergenic
1000231233 5:159317047-159317069 TGTGCTAGAAAGATGAAAGCTGG - Intronic
1001859384 5:175040142-175040164 GCTGCTATTAAGTTGAAAGAGGG - Intergenic
1002834383 6:853565-853587 GCTGCTAACCAGATGATTGCTGG + Intergenic
1003705057 6:8517653-8517675 ACCGCTAATCAGAAGAAAGCTGG + Intergenic
1007162663 6:39804667-39804689 GCAGCTAATTAGAGGAAGGCTGG - Intronic
1007502187 6:42306698-42306720 GATGCTAATGAGAGGAGAGCTGG - Intronic
1008482145 6:51996858-51996880 GCTGTTGATAAGTGGAAAGCTGG - Intronic
1009883132 6:69594384-69594406 GCTGTTAATAAAATGTAAGATGG - Intergenic
1011130473 6:84046982-84047004 GCTGCTGAAAAGAGCAAAGCTGG + Intronic
1011648962 6:89488210-89488232 GCTGAGAACAAAATGAAAGCAGG - Intronic
1011733552 6:90291011-90291033 GCTGCTGATGTGATGAGAGCCGG - Intronic
1015613297 6:135049014-135049036 GCTAAAAATAGGATGAAAGCAGG + Intronic
1016478004 6:144449567-144449589 GCTGCTGTTAAGATGACAGGAGG + Intronic
1016641475 6:146354154-146354176 GCTGCTAGTTAGATGGGAGCAGG + Intronic
1017218989 6:151944072-151944094 TCTTCAAATAAAATGAAAGCTGG + Intronic
1024990891 7:55233961-55233983 GCTGGTACGATGATGAAAGCTGG - Intronic
1028806728 7:95035930-95035952 GAGGCCAATAAGATGATAGCTGG + Intronic
1029918774 7:104239723-104239745 TCTGCTAATAAGCTGTAGGCTGG - Intergenic
1035705731 8:1672964-1672986 GCTGCTGAGAAAATGAAAGTGGG - Intronic
1040038409 8:42893866-42893888 GCTGCTTATCAGATTAAAGAGGG - Intronic
1042028088 8:64445178-64445200 GCAAGTAATAAGATGAGAGCTGG + Intergenic
1046794047 8:118351320-118351342 GTTGCTGATTAGATCAAAGCTGG + Intronic
1057870201 9:98710996-98711018 TCTGGGAATAAGTTGAAAGCTGG + Intergenic
1062157592 9:135061890-135061912 GCTGCTAACAAAATGCTAGCCGG + Intergenic
1187388516 X:18870355-18870377 AATGCCAATAAGAAGAAAGCAGG - Intergenic
1189734449 X:44055449-44055471 GCTGCTCTTGAGCTGAAAGCAGG - Intergenic
1195816928 X:108897772-108897794 GCTGCTAATAAGAAAATACCTGG - Intergenic
1198746980 X:139900991-139901013 GCTGCTACTTAGATCAAAGAAGG + Intronic
1201312658 Y:12610961-12610983 ACTGCTAAAGAGATGAGAGCGGG - Intergenic