ID: 1177202809

View in Genome Browser
Species Human (GRCh38)
Location 21:17977034-17977056
Sequence GCTCCATAACACTTTAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177202807_1177202809 -10 Left 1177202807 21:17977021-17977043 CCTGGGGTTGCAAGCTCCATAAC 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1177202809 21:17977034-17977056 GCTCCATAACACTTTAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 82
1177202802_1177202809 30 Left 1177202802 21:17976981-17977003 CCAACTAGCCACACTGTAGTAGA 0: 1
1: 0
2: 1
3: 1
4: 68
Right 1177202809 21:17977034-17977056 GCTCCATAACACTTTAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 82
1177202803_1177202809 22 Left 1177202803 21:17976989-17977011 CCACACTGTAGTAGAAACAGTGT 0: 1
1: 0
2: 1
3: 11
4: 139
Right 1177202809 21:17977034-17977056 GCTCCATAACACTTTAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177202809 Original CRISPR GCTCCATAACACTTTAAAGG AGG Intronic
901867250 1:12115083-12115105 ACTCCATAACCGTTTAAAGCTGG - Intronic
909162754 1:72174427-72174449 GCTCTATAATACTATAATGGTGG - Intronic
910462824 1:87466950-87466972 TCTCCAGAACACTTTATATGTGG - Intergenic
919117803 1:193303023-193303045 TCTCCTTAACATTTTAAAGAAGG - Intergenic
920290560 1:204920165-204920187 AATCCATAACACATTAAAAGGGG - Intronic
920439312 1:205968245-205968267 GCCCCCTAAACCTTTAAAGGAGG + Intergenic
1062961598 10:1576785-1576807 GCTGCAAAACACATTGAAGGTGG + Intronic
1063029307 10:2215748-2215770 GCTCCATAAAACTTAAAATCTGG + Intergenic
1063112292 10:3047638-3047660 GCTCCAAAACCCTTTAGAGAAGG + Intergenic
1064330198 10:14386568-14386590 GCTACCTAGCACTTGAAAGGTGG + Intronic
1068424991 10:56848274-56848296 GCCCCATAAAACTTTAAGGGAGG - Intergenic
1068747583 10:60552444-60552466 TATCCATAAAACTTTAAAGCCGG - Intronic
1070101989 10:73397190-73397212 CCTCCATAAGACTGTGAAGGTGG + Exonic
1071140631 10:82505604-82505626 GCTCCATATCACTGCAAAGGGGG - Intronic
1074250900 10:111746404-111746426 GCTCCATAAAATTTAAAAAGAGG + Intergenic
1075295728 10:121273281-121273303 GCTCCATAACATTTTGAACTGGG - Intergenic
1079017578 11:16882300-16882322 GTTCCATAAATCTTTAAATGTGG + Intronic
1085593358 11:77786059-77786081 GATCCTTAAAACTTTATAGGAGG + Intronic
1086252861 11:84838242-84838264 GCTGGAGAACACTTTGAAGGAGG - Intronic
1087058788 11:93958598-93958620 GCTACATAACTTTTTAAAGATGG + Intergenic
1091129759 11:133135633-133135655 TCTCCATAACAATTTAGAGTAGG + Intronic
1093027320 12:14256915-14256937 GTTCCATAACACTGTGAATGAGG - Intergenic
1093874431 12:24332199-24332221 GATCCATAACACTTATAAAGAGG + Intergenic
1095050600 12:37550924-37550946 GCTGCAGAACACTTGAAAGATGG + Intergenic
1100445772 12:94658118-94658140 GCTTCATATCACTGAAAAGGTGG - Intergenic
1106009099 13:25800875-25800897 GCAACAGAACACTTTTAAGGTGG - Intronic
1109996750 13:70137668-70137690 GCTCCAGATCATTTTAAAGCAGG + Intergenic
1113398063 13:109967246-109967268 GCTCCATAACACTGTTTAGAGGG + Intergenic
1116826687 14:49679677-49679699 GCTCAATAACACCTCCAAGGAGG + Intronic
1118412782 14:65500011-65500033 GTTCCATAACAGTTTGAAAGGGG - Intronic
1124857242 15:33401115-33401137 GCTAAATAACACTCTCAAGGGGG - Intronic
1129989327 15:79948537-79948559 GCTGCACCACACTTTAAGGGTGG + Intergenic
1135909479 16:26546041-26546063 GCACCATAGCACATTAAAGGGGG + Intergenic
1136369649 16:29828264-29828286 GCTCCTGAACACTTAAAATGTGG - Intronic
1139241544 16:65397348-65397370 GCTCCATAACACCTTATGGCTGG + Intergenic
1140646000 16:77030546-77030568 TCTCCTGCACACTTTAAAGGAGG - Intergenic
1140872715 16:79121780-79121802 GGTCCATTACTCTTTAAAAGTGG + Intronic
1141073194 16:80977389-80977411 AATCCAACACACTTTAAAGGTGG + Intronic
1145847360 17:28052823-28052845 GCTACAGAACACTTAAAATGTGG - Intronic
1156567825 18:38216227-38216249 GCTCTAGAAAACTTTAAACGTGG + Intergenic
1157807271 18:50667554-50667576 GATCCATAAAACTTTAGAAGGGG - Intronic
1158112089 18:53951648-53951670 GCTCTATGACTGTTTAAAGGAGG - Intergenic
1159566074 18:70051630-70051652 GCTTCATTACACTTAAAATGAGG + Intronic
925481407 2:4278388-4278410 GCTCTAGAACACTTGAAATGTGG + Intergenic
930708109 2:54524240-54524262 GCTTCATACCACTTTAAAAGGGG + Intronic
933265097 2:80173152-80173174 TTTCCATTACACATTAAAGGTGG - Intronic
939047656 2:137268554-137268576 GCTCCATGACAGTTTACAGATGG - Intronic
939834208 2:147108259-147108281 GATCAATAACAGTTCAAAGGAGG - Intergenic
941782677 2:169461706-169461728 TCTCCAAAACAATTCAAAGGAGG - Intergenic
941786941 2:169507168-169507190 CATCCAAAGCACTTTAAAGGGGG - Intronic
944920409 2:204407077-204407099 CTTCCAGAACACTATAAAGGAGG + Intergenic
944951167 2:204750749-204750771 GCTACAGAGCACTTGAAAGGAGG - Intronic
1172273758 20:33668758-33668780 GCTCCATAGCTCTTGTAAGGGGG - Intronic
1175397823 20:58679022-58679044 GCACCCGGACACTTTAAAGGAGG - Exonic
1177202809 21:17977034-17977056 GCTCCATAACACTTTAAAGGAGG + Intronic
950246863 3:11428464-11428486 GCACCAAAACAATTTAAAGAAGG - Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
959707624 3:109353412-109353434 ATTCCATAACTGTTTAAAGGAGG - Intergenic
965453290 3:168865343-168865365 ACCCCAGCACACTTTAAAGGTGG - Intergenic
966574660 3:181486569-181486591 TCACTATAACACTTTAAAAGAGG + Intergenic
971758634 4:30735491-30735513 GGTCAGTTACACTTTAAAGGAGG - Intronic
972961936 4:44463303-44463325 GCTACAAAGCACTTTAAATGTGG - Intergenic
974116759 4:57588476-57588498 GTCCCATAACAATTTAATGGTGG - Intergenic
979509308 4:121533860-121533882 CCTCAATAACTCTTTAAAGTAGG - Intergenic
979821663 4:125181254-125181276 GCTTCATAATTCTTTAAAAGAGG - Intergenic
981043558 4:140245429-140245451 GCTCCTGAATACTTGAAAGGTGG - Intergenic
988330513 5:29832957-29832979 GTTACATAACACTTTACAGGAGG + Intergenic
990735171 5:58852594-58852616 GATCCATAGCAATTTAAAAGAGG + Exonic
999751636 5:154632053-154632075 GCTTTAAAACATTTTAAAGGAGG + Intergenic
1001688304 5:173612694-173612716 TCACCATTACACTTTAGAGGTGG + Intronic
1003106867 6:3223897-3223919 GCTACATATCCATTTAAAGGAGG + Intergenic
1004141222 6:13019767-13019789 TATCCATAAAACTTTAATGGGGG + Intronic
1008365000 6:50667859-50667881 ACCCCATAACATTTTTAAGGAGG - Intergenic
1008458554 6:51740913-51740935 GCTTTATAACATTTTAAATGAGG - Intronic
1009449996 6:63789721-63789743 GCCCCATGACCATTTAAAGGTGG + Intronic
1010589013 6:77691274-77691296 ACTCCAAAACACATAAAAGGAGG + Intronic
1013823627 6:114184823-114184845 ACTCCATAAGACTTTAAGGCTGG - Intronic
1014973195 6:127844677-127844699 GCTCCATAACACTCTGAAAGAGG + Intronic
1021791975 7:24215165-24215187 GCCCCCTGACAGTTTAAAGGTGG + Intergenic
1031065629 7:117102062-117102084 GCTCCATAAAGCTATAAAGCTGG + Intronic
1031984663 7:128156004-128156026 GCTACAGAACACTTGAAATGTGG + Intergenic
1035787357 8:2272183-2272205 GCTCCAAAATACTTTAAACATGG - Intergenic
1035805450 8:2449533-2449555 GCTCCAAAATACTTTAAACATGG + Intergenic
1040354064 8:46598696-46598718 TCTACATAATACTTTAATGGTGG + Intergenic
1050575254 9:6988296-6988318 GCTCCATTCTACTTTAAAGAAGG - Intronic
1056599811 9:88037908-88037930 GGACCATAACAATTGAAAGGGGG - Intergenic
1057067556 9:92069726-92069748 GCACCATTATACTTTGAAGGAGG - Intronic
1059949221 9:119444539-119444561 GTTTCAAAACATTTTAAAGGTGG + Intergenic
1196037482 X:111161900-111161922 GCTACAGAACACTTAAAATGTGG - Intronic