ID: 1177207173

View in Genome Browser
Species Human (GRCh38)
Location 21:18023374-18023396
Sequence GTTCCAGCTGGTAGTCATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177207165_1177207173 30 Left 1177207165 21:18023321-18023343 CCAGTTGGTTGTGGTATGAGCCA 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1177207173 21:18023374-18023396 GTTCCAGCTGGTAGTCATACAGG 0: 1
1: 0
2: 0
3: 4
4: 68
1177207168_1177207173 10 Left 1177207168 21:18023341-18023363 CCAGACTGAGAGGGATGTTATTT 0: 1
1: 0
2: 0
3: 11
4: 176
Right 1177207173 21:18023374-18023396 GTTCCAGCTGGTAGTCATACAGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177207173 Original CRISPR GTTCCAGCTGGTAGTCATAC AGG Intronic
906281149 1:44554725-44554747 ATTCCAGCTGGAACTCAGACTGG - Intronic
907868787 1:58424196-58424218 GTTCCAGCTGGAAGGCAGTCAGG + Intronic
908659749 1:66423569-66423591 GTCCCAGCTGGAATCCATACTGG + Intergenic
915495145 1:156277130-156277152 GTTCCAGCTGGTAGTGGGACTGG + Exonic
916584122 1:166135138-166135160 GTTCTAGCTGGAAGTCATCTGGG - Intronic
920799329 1:209172931-209172953 GTTCCAGGTGGTAGTGAGACGGG + Intergenic
923675379 1:236076407-236076429 GTTCCACCTGGATGACATACAGG + Intergenic
1083490967 11:63014886-63014908 GTTCCTGCATGTAGCCATACTGG - Exonic
1084395555 11:68907328-68907350 GGTCCAGCTGGTAAACATGCAGG + Intronic
1089504952 11:118956734-118956756 CTGCCACCTGGTGGTCATACTGG + Intronic
1095797272 12:46233647-46233669 GAAACAGCTGGCAGTCATACAGG - Intronic
1099874014 12:88382475-88382497 GTTGCAGCTGGTCTTCAGACTGG + Intergenic
1100347243 12:93744266-93744288 GTTCCATGTGGTAGTTGTACTGG + Intronic
1106692666 13:32135135-32135157 GTTCCAGCGTGGTGTCATACAGG - Exonic
1111432378 13:88160831-88160853 GTTCCAACTGTAAGCCATACTGG + Intergenic
1117827000 14:59714468-59714490 TTTCCACCAGGTAGTCATATAGG + Intronic
1120043882 14:79784732-79784754 GTTCCAGCTGGGAGTCTATCGGG + Intronic
1125466890 15:39962012-39962034 CATCAAGCTGGTAGTCATTCTGG + Intronic
1135793639 16:25421457-25421479 GTTCCATCTGGATGACATACTGG + Intergenic
1140215359 16:73002923-73002945 TTTCCAGCTGGTAGAAGTACAGG - Intronic
1142372147 16:89688654-89688676 CTTCCAGGAGGTAGTGATACAGG + Intronic
1144957149 17:19024450-19024472 GTTCCAGGTGGTAGTGAGACGGG - Intronic
1145234432 17:21198752-21198774 GCTCCAGCTCGTACTCAAACTGG + Exonic
1146465362 17:33082079-33082101 TTTCCAGCTGGTAGTGAAAGAGG + Intronic
1148786597 17:50148963-50148985 GTTCCAGCTGTTTGTCAGAGAGG - Intronic
1151142701 17:72010260-72010282 CTTTTAGCTGGTAGTAATACCGG + Intergenic
1155795476 18:30030929-30030951 CTTCAGGCTGTTAGTCATACAGG - Intergenic
1161830732 19:6602326-6602348 GTTCCCGCTGGCATTCATCCAGG - Intronic
1166241089 19:41494320-41494342 GTTCCAACTTGTAGAAATACAGG + Intergenic
1166429686 19:42714087-42714109 TTTCCTCCTGATAGTCATACTGG - Intronic
1166443320 19:42835407-42835429 TTTCCTCCTGATAGTCATACTGG - Intronic
1166463005 19:43006064-43006086 TTTCCTCCTGATAGTCATACTGG - Intronic
1166469146 19:43062615-43062637 TTTCCTCCTGATAGTCATACTGG - Intronic
1166480291 19:43166146-43166168 TTTCCTCCTGATAGTCATACTGG - Intronic
1166490110 19:43251691-43251713 TTTCCTCCTGATAGTCATACTGG - Intronic
1167661546 19:50798604-50798626 GTGCCAGCTGGGAGTCCTCCCGG - Exonic
1167837228 19:52084120-52084142 GTTCCTGCTGGGACTCTTACCGG - Intronic
925873652 2:8293285-8293307 GTTCCTGCTGGTGGTTATAAGGG - Intergenic
932711612 2:74069513-74069535 GATCCAGGTGGTGGTCACACAGG - Intronic
943660938 2:190558570-190558592 GTTATAGCTGGTAATAATACAGG + Intergenic
946313387 2:218895216-218895238 CTTCCAGCTGGTGGGCCTACTGG - Intronic
948831676 2:240601351-240601373 GTTCCAGCTGGTAGACCAAATGG - Intronic
1171157130 20:22885841-22885863 GTTCCAGCTGGTGGACCAACTGG - Intergenic
1172855253 20:37996782-37996804 GTTGCAGCTGGCTGTCTTACAGG - Exonic
1174124798 20:48296418-48296440 GCTCCAGCTGGTGGACATCCGGG - Intergenic
1177207173 21:18023374-18023396 GTTCCAGCTGGTAGTCATACAGG + Intronic
1181933228 22:26419788-26419810 TTTCCATCTGGGAGACATACAGG + Intergenic
1183103409 22:35598051-35598073 TTCCCAGCTGGTAGTCTTCCTGG - Intergenic
1184977134 22:48070220-48070242 GTGCCAGCTGGTTATCTTACAGG + Intergenic
954041629 3:47892086-47892108 GTTCCATCTGGGACTCATAGAGG - Intronic
955324405 3:57998854-57998876 GTTCCAGTTGGAAGGCAGACTGG + Intergenic
977137288 4:93321264-93321286 CTTCTAGCTGGTAAACATACAGG + Intronic
984871363 4:184328291-184328313 GTTCCAGCTAGTACCCAGACAGG + Intergenic
987198535 5:15551410-15551432 TATCCAACTGGTAGTCACACTGG + Intronic
990842037 5:60092748-60092770 GTTCCAGCTGGCAGTGATATGGG - Intronic
991068118 5:62446246-62446268 GTTCCAACTGGCAGTTACACAGG - Intronic
995717882 5:115098098-115098120 TTTCCAACTGGTACTCAAACGGG + Intergenic
1000437622 5:161232422-161232444 TTTCCAGCTTGTAGTTTTACTGG - Intergenic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1004902873 6:20210228-20210250 GTACCAGCTGGCAGTCACAAAGG + Intronic
1005347574 6:24905492-24905514 GTTACAGCTGGTAGTTATCTTGG + Intronic
1008264849 6:49412236-49412258 GTTCTAGCTGCAAGTGATACAGG + Intergenic
1011802158 6:91029436-91029458 TTTCCAGCTGGTGGTAATAGCGG + Intergenic
1020995049 7:15252735-15252757 GTTCCAGCTGGAAATCTAACAGG - Intronic
1022343360 7:29488744-29488766 GTCCCAGCTGGGAGTGCTACTGG + Intronic
1022844852 7:34199733-34199755 TTTCCAGCTGGTAGATACACAGG + Intergenic
1046518909 8:115299822-115299844 GTTCCAGCCCATAGTAATACGGG + Intergenic
1051511965 9:17888223-17888245 TTTCCTGCTGGCTGTCATACAGG - Intergenic
1054705671 9:68459286-68459308 GATCCAGATGGTAGTTACACGGG - Intronic
1186117908 X:6324547-6324569 ATTCCAGCTGGTAGTTTCACTGG + Intergenic
1187187839 X:17004122-17004144 GATCCAGCTGGGAGTGTTACAGG + Intronic
1189348833 X:40262302-40262324 GGCCCAGCTGGTAGGCAGACCGG - Intergenic
1201364806 Y:13192007-13192029 GTTTCTGCTGATAGTCTTACTGG - Intergenic